ID: 1185310740

View in Genome Browser
Species Human (GRCh38)
Location 22:50152881-50152903
Sequence CTGCCCCCAGACCAAGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 348}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185310740_1185310745 -3 Left 1185310740 22:50152881-50152903 CCAAGGGCTTGGTCTGGGGGCAG 0: 1
1: 0
2: 4
3: 48
4: 348
Right 1185310745 22:50152901-50152923 CAGGCGACACACAGGGGCGCAGG 0: 1
1: 0
2: 3
3: 10
4: 103
1185310740_1185310744 -9 Left 1185310740 22:50152881-50152903 CCAAGGGCTTGGTCTGGGGGCAG 0: 1
1: 0
2: 4
3: 48
4: 348
Right 1185310744 22:50152895-50152917 TGGGGGCAGGCGACACACAGGGG 0: 1
1: 0
2: 0
3: 25
4: 267
1185310740_1185310743 -10 Left 1185310740 22:50152881-50152903 CCAAGGGCTTGGTCTGGGGGCAG 0: 1
1: 0
2: 4
3: 48
4: 348
Right 1185310743 22:50152894-50152916 CTGGGGGCAGGCGACACACAGGG 0: 1
1: 0
2: 0
3: 24
4: 205
1185310740_1185310748 22 Left 1185310740 22:50152881-50152903 CCAAGGGCTTGGTCTGGGGGCAG 0: 1
1: 0
2: 4
3: 48
4: 348
Right 1185310748 22:50152926-50152948 CAGAGTCAGGCTTGGAAGTCAGG 0: 1
1: 0
2: 3
3: 57
4: 457
1185310740_1185310749 26 Left 1185310740 22:50152881-50152903 CCAAGGGCTTGGTCTGGGGGCAG 0: 1
1: 0
2: 4
3: 48
4: 348
Right 1185310749 22:50152930-50152952 GTCAGGCTTGGAAGTCAGGCAGG 0: 1
1: 0
2: 1
3: 26
4: 291
1185310740_1185310746 9 Left 1185310740 22:50152881-50152903 CCAAGGGCTTGGTCTGGGGGCAG 0: 1
1: 0
2: 4
3: 48
4: 348
Right 1185310746 22:50152913-50152935 AGGGGCGCAGGAGCAGAGTCAGG 0: 1
1: 0
2: 3
3: 22
4: 377
1185310740_1185310747 14 Left 1185310740 22:50152881-50152903 CCAAGGGCTTGGTCTGGGGGCAG 0: 1
1: 0
2: 4
3: 48
4: 348
Right 1185310747 22:50152918-50152940 CGCAGGAGCAGAGTCAGGCTTGG 0: 1
1: 0
2: 2
3: 30
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185310740 Original CRISPR CTGCCCCCAGACCAAGCCCT TGG (reversed) Intronic
900385593 1:2409179-2409201 CCTCCCCCAGCCCAAGCACTCGG + Intronic
900430035 1:2597028-2597050 CTGACCCCAGAGCAAGGCCTGGG + Intronic
900477878 1:2884426-2884448 CTGCCCCCACACCAAGGGCTGGG - Intergenic
900557619 1:3288229-3288251 ATGCCCCCAGGCCCAGCACTTGG + Intronic
900663155 1:3796115-3796137 CTGCCGCCGGGCCAAGGCCTGGG - Exonic
900947323 1:5838456-5838478 CAGCCCCCGGCCCAAGCGCTCGG + Intergenic
901071078 1:6518818-6518840 CTGCCACCAGAGCAACCCTTTGG + Intronic
901478090 1:9504651-9504673 ATGCCCCCATATCAAGCCATGGG + Intergenic
901630332 1:10644891-10644913 CTGCCCGCAGCCCCAGCCCTCGG + Intronic
901738274 1:11325987-11326009 CTGCACCCAGCCCCAGCCCCGGG - Intergenic
902618864 1:17639012-17639034 AGGCCCCCAGGCCAGGCCCTGGG + Intronic
902734072 1:18388517-18388539 GTGACCCCAAGCCAAGCCCTGGG + Intergenic
903499434 1:23793310-23793332 CTGCCCTGAGCCCAAGCCCCAGG - Intronic
903865313 1:26393330-26393352 CGTCCCCAAGACAAAGCCCTGGG + Intergenic
904265575 1:29316860-29316882 CTGCCCCAAGAGCCAGGCCTTGG - Intronic
904520596 1:31092400-31092422 GAGCCACCACACCAAGCCCTTGG + Intergenic
904799409 1:33082061-33082083 CCGCCCCCAGCACAAGCCCGGGG - Intronic
904986006 1:34549461-34549483 ATGCTCCCACACCAAGCACTCGG - Intergenic
905653394 1:39671421-39671443 CTGCCCCCAGCCCAGGGCCCAGG + Intronic
906151052 1:43588048-43588070 CTGCCCGCAGACCATGTCCCTGG + Intronic
906196553 1:43933793-43933815 CGGCCCCCAGACAAGGCCCGGGG + Exonic
906236615 1:44214973-44214995 GTGCCCCCAGAACCAACCCTAGG - Intronic
906814479 1:48864885-48864907 TTGCCCCCATGCCAACCCCTTGG - Intronic
909541839 1:76800438-76800460 CTTGGCACAGACCAAGCCCTGGG + Intergenic
910398255 1:86812847-86812869 CTGCCCCCAGGCCTGGCCCATGG - Intergenic
910767233 1:90793863-90793885 CTATTCCCAGAACAAGCCCTAGG - Intergenic
911698902 1:100927264-100927286 CTGCCTCCTGACCAACCCCAGGG - Intronic
912969599 1:114268308-114268330 CTGTTCCCACCCCAAGCCCTAGG + Intergenic
915305616 1:154975752-154975774 CCGCCCCCAAACCAAGCCCAGGG - Intronic
915698934 1:157772381-157772403 CTGCCCCAAGAGCAAGCCAAAGG + Intronic
916833002 1:168512426-168512448 CTGCCCCAGCACCAAGCCCAGGG + Intergenic
919753673 1:201053603-201053625 CTGCCCCCAGACTGACCTCTGGG - Intronic
919824387 1:201493210-201493232 CTGGTCCCAGGCCAAGCCCAGGG + Intronic
922462606 1:225824733-225824755 CTTCCACCAGCCCAAGCCCAAGG - Intronic
922763282 1:228145294-228145316 CGGCCCTCAGACCAGGCTCTGGG - Intronic
922984721 1:229857406-229857428 CTTCCTCCAGACCTTGCCCTGGG + Intergenic
923146866 1:231204180-231204202 GTCCTCCCAGACCTAGCCCTTGG - Intronic
924655548 1:245972087-245972109 CTGACAACAGACCATGCCCTAGG + Intronic
1063434300 10:6018152-6018174 CTGCCCCCATGCCAAGCCCAGGG - Intronic
1063565852 10:7171903-7171925 GTGCCCGCCGACCAAGCCCGAGG - Exonic
1064787585 10:18915995-18916017 ATGACCCCAAACCAGGCCCTGGG - Intergenic
1065511227 10:26480248-26480270 CTGACCCCACTCCAAGACCTAGG + Intronic
1065989270 10:30991936-30991958 CTGCCCCAAGATCAACTCCTAGG + Intronic
1067258242 10:44663908-44663930 CTGCCCCTAGACATACCCCTAGG - Intergenic
1067627148 10:47933097-47933119 CTCTCACCAGATCAAGCCCTGGG - Intergenic
1067692770 10:48512799-48512821 CTTCCTTGAGACCAAGCCCTCGG + Intronic
1071384295 10:85104158-85104180 CTGCCCTCAGACAAAAGCCTGGG - Intergenic
1071841527 10:89476764-89476786 CTGACCCCAGACCAGGCCAAAGG + Intronic
1071891094 10:90008255-90008277 CTGCCTCCAGGCAAAGCTCTGGG + Intergenic
1072807244 10:98431335-98431357 CTTGCCCCACTCCAAGCCCTGGG + Intronic
1072964026 10:99955865-99955887 CTGCTTCCATAACAAGCCCTTGG + Exonic
1073449872 10:103602952-103602974 CTGTCCCCGGGCCAAGCCATCGG - Exonic
1073491182 10:103854712-103854734 CTGCCCCCAGCCCCAGGCCTAGG + Intronic
1074219368 10:111421104-111421126 CTGCCACCACACCATGACCTTGG + Intergenic
1075517131 10:123118175-123118197 CTGCTCCCAGTCCAGGCACTGGG - Intergenic
1076738148 10:132467877-132467899 CTGCCCCCAGGCAGAGTCCTGGG - Intergenic
1077027587 11:448165-448187 CCGCCCACAGACCATGTCCTCGG + Intergenic
1077159820 11:1107592-1107614 CTCCTCCCAGGCCAAGCCCCCGG - Intergenic
1077299413 11:1840228-1840250 CTGGCCCCAGACCTTGCACTGGG - Intronic
1077299575 11:1840797-1840819 CCGCCCCCACACCCACCCCTAGG + Exonic
1077409615 11:2397438-2397460 CTGCCCTCCGGCCAACCCCTAGG - Intergenic
1077504058 11:2922106-2922128 CTGCCCGATGACCAGGCCCTGGG - Exonic
1077508150 11:2941596-2941618 CTGCCCCCAGCCCCATCGCTGGG - Intergenic
1077535495 11:3122170-3122192 CTGCCCCTGGACCCATCCCTGGG - Intronic
1078442174 11:11377247-11377269 CAGCTCCCAGTCAAAGCCCTGGG + Exonic
1081812242 11:45920624-45920646 ACGCCCCCAGAACAACCCCTTGG + Intergenic
1083318191 11:61828893-61828915 CTGCCTCCAGACAAACCCCGAGG - Intronic
1083905094 11:65663817-65663839 CTCCCCCAAGACCAAGCCCAAGG + Intergenic
1084671500 11:70609240-70609262 CTGCCGTCAGACCTAGCCCAGGG - Intronic
1084752611 11:71214145-71214167 CTGCCTCCTGACCAAACCCTGGG + Intronic
1084956849 11:72696148-72696170 CTGCCCCCCGACCCTGTCCTTGG - Intronic
1086753786 11:90532817-90532839 GTGCACACAGACCAAGCCCTTGG - Intergenic
1088880362 11:113968888-113968910 CTGCCCCCAGGTCTAGCTCTGGG + Intergenic
1090027671 11:123181586-123181608 CTGCTCCCCGACCAGGCTCTCGG + Intronic
1091015555 11:132048173-132048195 CTGCTGCCTGACCAATCCCTGGG + Intronic
1091646138 12:2273801-2273823 CTGCCCCCTAACCAAGCCCGGGG - Intronic
1092228810 12:6765984-6766006 CTGACCCCAAAAAAAGCCCTGGG - Intronic
1092260903 12:6952832-6952854 CAGCCCCCAGCCCATGCCTTTGG - Intronic
1093774141 12:23052821-23052843 CTGCCCCAGGACCTAGCTCTGGG + Intergenic
1095951403 12:47783804-47783826 CTGCCCGCCCACCATGCCCTTGG - Exonic
1096550705 12:52369961-52369983 AAGCCCCCAGCCCCAGCCCTGGG - Intergenic
1097473287 12:60021915-60021937 AAGCCCCCATTCCAAGCCCTAGG - Intergenic
1097584865 12:61503347-61503369 CTGGCCACAGACCAGACCCTGGG - Intergenic
1099388040 12:82042347-82042369 CTTCCTCCCCACCAAGCCCTCGG + Intergenic
1100265086 12:92968217-92968239 CTTCCCCCAGAGCAAGCGCTGGG + Intergenic
1103189506 12:118989114-118989136 CTGCCCCCAGCCCAGGACCTAGG - Intronic
1103274475 12:119700205-119700227 CAGCCCACAGTCCCAGCCCTGGG - Intronic
1103443641 12:120980421-120980443 CTGCCCCCTGTCCAGGCCCTCGG - Intronic
1103721837 12:122979390-122979412 CTGCCCCCAGACCAAGGCAACGG - Exonic
1104416738 12:128601902-128601924 CTGCTCCCAGAGCAAGCAATCGG - Intronic
1104687640 12:130798286-130798308 GTGCCACCACACCCAGCCCTAGG + Intronic
1105003065 12:132703601-132703623 CTGCCCTCAGTCCCAGCCCCTGG - Intronic
1105209218 13:18247940-18247962 CTGCCCCAACACCCAGCCCGGGG - Intergenic
1105474936 13:20721228-20721250 CTGCCCCCAGCCTAGGCCCCAGG + Intronic
1106415074 13:29539655-29539677 TTTCCCCCACACCAAGCCCAGGG + Intronic
1107711228 13:43152375-43152397 CTGCCCCCGGCCCAGGCCCCAGG + Intergenic
1110458100 13:75712364-75712386 CTGCCCTAAGAACAACCCCTGGG - Intronic
1113594119 13:111519373-111519395 CTGTCCCCATACCAAGCTCCAGG - Intergenic
1113682930 13:112256912-112256934 CCGCACCCACACCAGGCCCTGGG + Intergenic
1114455567 14:22851213-22851235 CTGCCACCAGTCCTGGCCCTAGG + Intergenic
1115541973 14:34429312-34429334 CTGCCCCTAGTCCAAGACCATGG + Intronic
1118757248 14:68853941-68853963 CTCCACCCACACCAGGCCCTGGG + Intergenic
1118995592 14:70832698-70832720 CTGCCCCCAGACAAGACTCTGGG - Intergenic
1119895468 14:78215888-78215910 TGGCACCCAGACCAAGCCCTGGG - Intergenic
1120261365 14:82189710-82189732 CTGCCCCCAGACCACGGCAGAGG + Intergenic
1121009567 14:90512152-90512174 CCTCCCCCAGGCCCAGCCCTGGG - Intergenic
1121089943 14:91174232-91174254 CTTCCCCCACACCTTGCCCTGGG + Intronic
1122072052 14:99211272-99211294 CAGTCCCCAGCCCAAGCCCATGG + Intronic
1122243063 14:100382038-100382060 CAGGCCCAGGACCAAGCCCTGGG + Intronic
1124095833 15:26648146-26648168 CTGCCCCTAGCCCCAGCCCCTGG + Intronic
1124695596 15:31861961-31861983 CTGCTCCCAGAGCATGTCCTTGG - Intronic
1127731056 15:61802242-61802264 CTTCCCACAGATCAGGCCCTTGG + Intergenic
1128271541 15:66314672-66314694 CAGCCCACTGACCAATCCCTTGG + Intronic
1128376809 15:67082405-67082427 CTGCCCCCACTTCAAACCCTAGG - Intronic
1129035139 15:72644522-72644544 CTGCACCCAGACTGACCCCTGGG - Intergenic
1129214743 15:74092694-74092716 CTGCACCCAGACTGACCCCTGGG + Intergenic
1129249881 15:74302994-74303016 CTGCCCCCAGACCCACACCCAGG + Intronic
1129325523 15:74798477-74798499 CTGCCCGGAGAACGAGCCCTGGG - Intronic
1129390641 15:75218967-75218989 CTGCACCCAGACTGACCCCTGGG - Intergenic
1129670770 15:77606561-77606583 CTTCCCCCAGCCCCAGCTCTGGG + Intergenic
1129682884 15:77667930-77667952 TTGCCCTCAGCCCCAGCCCTGGG - Intronic
1129731877 15:77937045-77937067 CTGCACCCAGACTGACCCCTGGG + Intergenic
1129902783 15:79164539-79164561 CTGCTCCCAGGCCCAGGCCTGGG + Intergenic
1131148998 15:90035204-90035226 CAGCCCCCACACCATGCCCCAGG - Intronic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1131771277 15:95740567-95740589 CAACCTCCAGAACAAGCCCTTGG - Intergenic
1132196865 15:99920031-99920053 CTGCCCCCACCCCCAGCTCTGGG + Intergenic
1132514349 16:359350-359372 CTGGCCCCAGTCCCAGCCCCTGG - Intergenic
1132785684 16:1656081-1656103 CTGCCCCCAGCCCAGATCCTGGG + Exonic
1133320293 16:4909329-4909351 CTGTCCCCAGGCCCAGCCATAGG - Intronic
1134064777 16:11220986-11221008 CTTCCACCACCCCAAGCCCTGGG - Intergenic
1134341634 16:13352114-13352136 CTCCCTCCACTCCAAGCCCTTGG + Intergenic
1135326219 16:21527399-21527421 CTGCCCCCATCCCAAGCTCCAGG + Intergenic
1135415774 16:22267010-22267032 CTGCCCCCAAACCAGTGCCTGGG - Intronic
1136183909 16:28573806-28573828 CTGCCCTCAGACCCAGGCCTGGG - Intronic
1138455889 16:57120500-57120522 CTGCTCTCAGACCCAGCCCCTGG - Intronic
1139476899 16:67207338-67207360 CTGCTCTCTGGCCAAGCCCTGGG - Exonic
1140580634 16:76227225-76227247 CTGCCCCCAGCCCAAACCCATGG - Intergenic
1141772239 16:86096391-86096413 CCTCCCCCAGTCCCAGCCCTAGG + Intergenic
1141919214 16:87124058-87124080 CACGCCCCAAACCAAGCCCTGGG + Intronic
1142039266 16:87882126-87882148 CTGCCCCCATCCCAAGCCCCAGG + Exonic
1142285203 16:89168818-89168840 CAGCCCCCAGACCAAGACCAGGG + Intergenic
1142750862 17:1986823-1986845 CTGCCCCCCGACCCAGGCCCAGG + Intronic
1143375048 17:6462422-6462444 CTGCCCCCTGAACAAACCCTTGG + Intronic
1143620176 17:8076050-8076072 CTTCCCCAAGGCCAAGCCCCTGG + Intronic
1143776990 17:9206048-9206070 CTGCCACCAGTCCCAGACCTAGG - Intronic
1143982515 17:10882183-10882205 ATGGCCCCAGACCCAGCCCTCGG - Intergenic
1144848972 17:18234495-18234517 CTGCCCCCAGACCACCCCCTCGG - Intronic
1144950362 17:18990542-18990564 CGTCCCCCAGCCCAAGCCCAGGG - Intronic
1145265878 17:21379408-21379430 CTGCTCCCAGGCCCAGCTCTGGG + Intronic
1146301242 17:31691486-31691508 CTGCCCACAGCCCAAGCACAGGG + Intergenic
1146928593 17:36762143-36762165 TTTCCCCCAGCCCAAGCCATGGG - Intergenic
1146934621 17:36805076-36805098 CTGCCCCCAAGCCTGGCCCTGGG + Intergenic
1147312752 17:39605080-39605102 CTGCCCCCTTACCAACGCCTTGG + Exonic
1148683939 17:49490347-49490369 CTGACCCCAGACCAGTCCCCAGG + Intergenic
1148836561 17:50468824-50468846 CTGCCCCCAGCCCCGGCCCCAGG - Exonic
1149563360 17:57625219-57625241 CTGGCCCCCAACCATGCCCTTGG - Intronic
1150424573 17:65067167-65067189 TTCCCCTCAGACCAAACCCTAGG - Intergenic
1150481747 17:65516539-65516561 CCGCCCCCATCCCCAGCCCTAGG - Intergenic
1150712428 17:67543338-67543360 GGGTTCCCAGACCAAGCCCTGGG + Intronic
1150822378 17:68445884-68445906 CTGCCCAAGGAGCAAGCCCTGGG + Intronic
1151214773 17:72569881-72569903 CAGCCCCAAACCCAAGCCCTTGG - Intergenic
1151260537 17:72912574-72912596 CTGCCACCACACCAAGCTCAAGG + Intronic
1151684748 17:75639930-75639952 CAGCCCCCGAAGCAAGCCCTTGG + Exonic
1151713331 17:75818843-75818865 CTGACCCCAGACCCAGTCCTGGG - Intronic
1152092219 17:78253238-78253260 CGACCCCCAGCCCCAGCCCTGGG - Intergenic
1152626082 17:81388518-81388540 CACCTCCCAGACCCAGCCCTTGG - Intergenic
1152645942 17:81468553-81468575 CTGCCCCCAGAACAGGCCCTGGG + Intergenic
1152786572 17:82251072-82251094 CTGCCCCCAGGGCATGCTCTGGG + Intronic
1152835224 17:82525500-82525522 TAGCCTCCAGACCAGGCCCTTGG - Intronic
1153070119 18:1095849-1095871 CTACCCCCAGAAATAGCCCTGGG - Intergenic
1156456812 18:37299427-37299449 CGGCCCCCATACCAGGCCCCTGG - Intronic
1157122458 18:44924314-44924336 CTGACTCTACACCAAGCCCTAGG - Intronic
1157327385 18:46678921-46678943 CTGCCCCAAGCCCAGGCCCTGGG + Intronic
1158343268 18:56489076-56489098 CTAACACCAAACCAAGCCCTGGG + Intergenic
1160345752 18:78130515-78130537 CTGCTCCCACACCAAGCCTTGGG - Intergenic
1160578788 18:79871957-79871979 ATGCCACCGGACCAAGCTCTGGG + Intronic
1160902036 19:1433549-1433571 CTGCCCCCACGCCCAGGCCTTGG + Intronic
1160983175 19:1826086-1826108 CTGCACCCACACAAAGCCCAGGG - Intronic
1161108153 19:2454833-2454855 CTGCCCCCCAACCTAACCCTGGG - Intronic
1161189368 19:2944665-2944687 CTGCCCCCAGCCCTACCCCTCGG + Intronic
1161237161 19:3203907-3203929 CTGCCCCCATGGCAACCCCTGGG - Intronic
1161320148 19:3637359-3637381 CTGGCCCCGGACCAGGCGCTGGG - Intronic
1161323704 19:3652945-3652967 ATGTCCCCAGACCCAGCCCTTGG - Intronic
1161396468 19:4047363-4047385 CTCCCCCCAGCCCAGGGCCTCGG + Exonic
1162361971 19:10226052-10226074 CTACCCAGAGAGCAAGCCCTAGG + Intronic
1163146167 19:15380270-15380292 GTGCCCCCAGAGCCAGCCCCCGG - Exonic
1163811927 19:19438485-19438507 CTGCCCTCAAACAATGCCCTGGG - Intronic
1164443937 19:28301035-28301057 CTGACCCCACGCCCAGCCCTAGG + Intergenic
1164579025 19:29422944-29422966 CTTCCCACAGACCCATCCCTGGG + Intergenic
1165084412 19:33333540-33333562 CTCCCCCCAGCCCCAGCCCCTGG - Intergenic
1165159154 19:33805727-33805749 CTGTTCCCAAACCAAGCCCTTGG + Intronic
1165357682 19:35313743-35313765 CTGCCCCCACACCTGGCCCTGGG + Exonic
1165431514 19:35775889-35775911 CTCCTCCCAGCCCAGGCCCTAGG - Intronic
1166053503 19:40274980-40275002 CTGTCCCCAGAATAAGCCCTGGG + Intronic
1166054369 19:40279679-40279701 CTGCTCCCGCACCAAGCCTTAGG + Intronic
1166140334 19:40802002-40802024 GTGGCCCCAGACCAAGCACGGGG + Intronic
1166944842 19:46390397-46390419 CTGCCCCTAGCCCAGGGCCTGGG - Exonic
1167985731 19:53313539-53313561 CTAGCCCCACACCAATCCCTGGG + Intergenic
1168063531 19:53907233-53907255 CTCCCCCCAGACCCCGCCCCTGG + Exonic
924967108 2:88115-88137 CTGCACCCAGCCCCAGCTCTTGG - Intergenic
925373978 2:3368505-3368527 CTGCCCCCAGACCTACACATGGG + Intronic
928346507 2:30502527-30502549 CTGTCCCCAGCCCCAGCCCTAGG + Intronic
929237040 2:39616342-39616364 CTGCCCACAGAGCAAATCCTGGG + Intergenic
929258384 2:39838745-39838767 CTGACCCCAGTCCAGCCCCTTGG - Intergenic
929440435 2:41962085-41962107 CTCCCCCTAGACCAAGCCTCAGG - Intergenic
931372367 2:61675703-61675725 CAGCACCTAGACCAAACCCTTGG + Intergenic
931648947 2:64451839-64451861 CTGCCCCCAGCCCCAGTACTTGG + Intergenic
931683028 2:64768375-64768397 CTTGCCCCAGGCCAAGCCCTCGG - Intergenic
932418566 2:71588155-71588177 CTTCCCCCAAACCCGGCCCTTGG - Intronic
932477270 2:72014079-72014101 CTGCCCCTGGACCCAACCCTAGG + Intergenic
934738997 2:96705573-96705595 CTGCTCCAAGGCCAAGCTCTAGG + Intergenic
940724980 2:157326732-157326754 CTTCCTCAAGCCCAAGCCCTGGG + Intronic
940781233 2:157936246-157936268 CTGGCCCCAAACCAAGCCTTTGG - Intronic
944315387 2:198279804-198279826 CAGCTTCCATACCAAGCCCTAGG - Intronic
946155098 2:217801998-217802020 CTGACCCCAGACTCAGTCCTGGG + Exonic
946341695 2:219073746-219073768 CTGGCCCCAGCCCCAGCCCCGGG + Intergenic
946650677 2:221890351-221890373 CTGTCCCCAGCACACGCCCTCGG + Intergenic
946675752 2:222157279-222157301 TTGCCCCCTGACCATGCCATAGG - Intergenic
946706639 2:222464771-222464793 CTGCACCCAGCCCAAGCACAGGG + Intronic
947119592 2:226800429-226800451 CTGCCCCCAGTCACTGCCCTTGG - Intergenic
947699112 2:232217716-232217738 CTTCCCCCATACCTCGCCCTAGG - Intronic
947798434 2:232909722-232909744 CTCCCCCCACACCTAACCCTTGG + Intronic
947982168 2:234419920-234419942 CTGCCTCCAGACCCTGCCATTGG - Intergenic
948233700 2:236370829-236370851 CTTCCTCCAGGCCCAGCCCTCGG - Intronic
948383532 2:237567570-237567592 CAGCCCCCAGCCTGAGCCCTGGG + Intergenic
948813978 2:240500319-240500341 CCGCCCCCAGAGCAGCCCCTTGG - Intronic
1169030135 20:2400452-2400474 CTGCCCCCAGCCTAGGCCCGAGG + Intronic
1169471249 20:5887549-5887571 TGGCCACCAGACAAAGCCCTCGG + Intergenic
1169750071 20:8982524-8982546 CTGCCCCCAGCCCCAGCCCCTGG - Intergenic
1170582661 20:17710872-17710894 CTGCCCACACACCCAGCCCTGGG - Intronic
1172870815 20:38134533-38134555 CTGGCCCAAGACCAAGGCCGTGG - Intronic
1173320542 20:41983498-41983520 CTGACCCCAGAGCCAGTCCTTGG - Intergenic
1173596914 20:44264435-44264457 CTGCCCCCAGGCCAAGATCTTGG + Exonic
1174080384 20:47967222-47967244 CTGCCCCCAGCCCCAGCAGTGGG - Intergenic
1174110348 20:48194196-48194218 CACACCCCAGACAAAGCCCTGGG - Intergenic
1174137209 20:48388051-48388073 CTGCCCCCAGCCCCAGCAGTGGG + Intergenic
1174922955 20:54724434-54724456 CTGCCCCCCGACAAACCCCAGGG + Intergenic
1175182140 20:57156227-57156249 CTGCCCCCAGCCCACTCCTTGGG - Intergenic
1175339466 20:58218929-58218951 CTGCCCCCAGTCCACTCCCCTGG + Intronic
1175777817 20:61664037-61664059 CAGCCCCCACACAATGCCCTTGG - Intronic
1175876092 20:62230869-62230891 CTGCCCCCTGCTCATGCCCTTGG - Intergenic
1177201286 21:17959165-17959187 CTGCCCCCAGCTTAAGTCCTGGG + Intronic
1178538472 21:33429672-33429694 CAGCCCCCAGAAAAAGCCCTGGG - Intronic
1179923896 21:44522119-44522141 CTGCCCCCAGCACAGTCCCTTGG - Intronic
1180636558 22:17266773-17266795 CAGCCCCCAGATCAAGCCTCAGG - Intergenic
1180767039 22:18351357-18351379 CTGCCCCTACACCCAGCCCGGGG + Intergenic
1180779274 22:18511022-18511044 CTGCCCCTACACCCAGCCCGGGG - Intergenic
1180811991 22:18768342-18768364 CTGCCCCTACACCCAGCCCGGGG - Intergenic
1180970093 22:19810722-19810744 CTGCACCCAGACAACGCCCAGGG - Intronic
1181144741 22:20836686-20836708 CAGCCCCCTGAGAAAGCCCTAGG - Intronic
1181198146 22:21202586-21202608 CTGCCCCTACACCCAGCCCGGGG - Intergenic
1181401598 22:22653218-22653240 CTGCCCCTACACCCAGCCCGGGG + Intergenic
1181408899 22:22704378-22704400 CTGCCCCCAGACCCTGCCCCAGG + Intergenic
1181439891 22:22930334-22930356 CTGCCCAGAGACCCAGGCCTGGG + Intergenic
1182427706 22:30283644-30283666 CTGGCCCCATATCCAGCCCTGGG - Intergenic
1183033105 22:35120229-35120251 CTTCCCCCGGACCCAGCCCCTGG + Intergenic
1183060586 22:35334226-35334248 CTTCCCCAGCACCAAGCCCTGGG + Intronic
1183380505 22:37488409-37488431 CTTTCCCCAGGCCAAGCACTGGG + Intergenic
1183641491 22:39095566-39095588 CTGCCCCTAGTCCTCGCCCTTGG + Intergenic
1184098040 22:42327168-42327190 CAGCCTCCAGACTCAGCCCTGGG - Intronic
1184786980 22:46676691-46676713 CTGGGCCCACACCAACCCCTTGG - Intronic
1184829460 22:46974998-46975020 CTGCCCCTACACCATGCCATAGG - Intronic
1185067189 22:48638443-48638465 CTCCCCCGACACTAAGCCCTGGG + Intronic
1185217669 22:49611358-49611380 CAGCCCCCAGACCCAGCTCTAGG + Intronic
1185310740 22:50152881-50152903 CTGCCCCCAGACCAAGCCCTTGG - Intronic
1203228661 22_KI270731v1_random:92251-92273 CTGCCCCTACACCCAGCCCGGGG + Intergenic
950508272 3:13409761-13409783 CTGCCTCCAGACCAAGCAGAAGG + Intronic
950782029 3:15400274-15400296 CTGCACCCCCACCAAGCCCCAGG + Intronic
952945216 3:38474393-38474415 CAGCCTGCAGCCCAAGCCCTAGG - Intronic
953411188 3:42691332-42691354 CTCCCTCCAGACCAAGCACCCGG - Intronic
953569694 3:44061481-44061503 CTGCCACCACACTAACCCCTGGG - Intergenic
954443393 3:50533962-50533984 CTGCCGTCAGGCCAACCCCTGGG + Intergenic
955416958 3:58701372-58701394 CTGGCACCAGAAAAAGCCCTTGG - Intergenic
956765117 3:72478297-72478319 CTGCCTCCCGACCCAGCACTTGG + Intergenic
959327217 3:104952640-104952662 CTGACCTCAGGCCAAGCCCAGGG + Intergenic
961353445 3:126318331-126318353 CTACCCCCAGGCTAATCCCTGGG - Intergenic
961485241 3:127211536-127211558 CAGCACCCAGGCAAAGCCCTGGG + Intergenic
961552320 3:127676526-127676548 CTGCCCACAGATCAACCCCGTGG + Exonic
961653578 3:128429420-128429442 CTGCCCCCATCCCGGGCCCTGGG + Intergenic
963643899 3:147889860-147889882 CTGCCACCAGAGAAAGCCCAAGG + Intergenic
966914027 3:184575182-184575204 CTCACCCCAGAGCAAGCCCAGGG - Intronic
968819128 4:2836785-2836807 CTGCCCCTAGGGCAAGGCCTAGG - Exonic
968916233 4:3498120-3498142 CTCCTCCCAGACCCCGCCCTGGG - Intronic
969459649 4:7322205-7322227 CTGCCCCTAGGACAAGCACTGGG - Intronic
969460570 4:7326758-7326780 CTGGCCCCTGACCAGGGCCTGGG - Intronic
969835290 4:9835365-9835387 CTGTGCCCAGACCAGGACCTAGG + Intronic
971346146 4:25813546-25813568 TTGCCCCCATCCCAAACCCTGGG - Intronic
971994161 4:33942718-33942740 GTGCCCCTAGAGCAGGCCCTGGG + Intergenic
972285711 4:37645960-37645982 CTGCCCTCAGGCCCTGCCCTGGG - Intronic
972639372 4:40911756-40911778 CTGGTCCCAGACCAACACCTAGG + Intronic
972922042 4:43955974-43955996 CTGGCCCCATCCAAAGCCCTGGG + Intergenic
975436687 4:74361859-74361881 CTGCACTCAGATGAAGCCCTGGG - Intergenic
975710686 4:77157636-77157658 CTGCCCTCAGCCCCAGCCCCGGG + Intronic
979488523 4:121297009-121297031 CTGCTCCCATGCCCAGCCCTTGG - Intergenic
981654052 4:147091785-147091807 CTGCCCCCAGACCAAAGCTTTGG + Intergenic
982223443 4:153144049-153144071 CAGCCCACAGACGCAGCCCTTGG + Intergenic
982911521 4:161148563-161148585 AGGCCCCCATTCCAAGCCCTAGG + Intergenic
983719785 4:170835868-170835890 CTGCTCCCAACCCCAGCCCTAGG - Intergenic
984314093 4:178103678-178103700 GAGCCCCCACACCCAGCCCTAGG + Intergenic
985622738 5:963956-963978 CTGCCGTCAGACCAGGCACTGGG - Intergenic
985962850 5:3316035-3316057 CTTCTCCCAGCCCAACCCCTGGG - Intergenic
987402832 5:17495714-17495736 CAGCTCCCAGACCAAGACCTGGG + Intergenic
990530667 5:56670153-56670175 CTGGCTCCATACCAAGGCCTCGG + Intergenic
992166786 5:74060068-74060090 CTGTCCCCAGCTCAAGCCCCTGG - Intergenic
992432408 5:76722193-76722215 CTGTCCCCATCCCCAGCCCTGGG + Intronic
992762118 5:79959886-79959908 CTGCCTCTAAACCCAGCCCTTGG - Intergenic
994361186 5:98850270-98850292 TTTCCCCTATACCAAGCCCTTGG - Intergenic
997526234 5:134555027-134555049 AGGCCCCGAGAACAAGCCCTGGG + Intronic
997599634 5:135130481-135130503 CTGATCCCAGAGCAATCCCTGGG - Intronic
997818043 5:137036772-137036794 CTGCCCCCAGGCTAAGCCCTTGG + Intronic
998369050 5:141649603-141649625 CTGCCCCCTGACCAACACCATGG + Intronic
999754609 5:154655063-154655085 CTGCCCCCACACCCAGACCCAGG + Intergenic
1000091170 5:157930915-157930937 CTGCACCCTGACTAGGCCCTGGG - Intergenic
1001617723 5:173056510-173056532 CTTCCCCCAGCCCAGGCCCCTGG - Intronic
1005926457 6:30449549-30449571 CTGCCCCCAGGACAAGCCCTTGG + Intergenic
1005928179 6:30462121-30462143 CTGTCCCCAGGACAAGCCCTTGG + Intergenic
1007742284 6:44020254-44020276 ATCACCCCAGAGCAAGCCCTTGG - Intergenic
1013199130 6:107875152-107875174 CTGCACCCAGCCCAAGGCCCTGG + Intronic
1017841661 6:158227278-158227300 GTGCCCCCAGGCCCAGCCTTAGG + Intergenic
1017935270 6:158999795-158999817 CCGCCCCCAGACAGAACCCTGGG - Exonic
1018757088 6:166859365-166859387 TTGCCCCCAAAGCACGCCCTTGG + Intronic
1018811865 6:167304234-167304256 CTCCCTCCAGCCCCAGCCCTGGG - Intronic
1019546734 7:1581137-1581159 GAGCCCCCAGACCTGGCCCTGGG - Intergenic
1019622275 7:1998415-1998437 CTGAGCACAGGCCAAGCCCTCGG - Intronic
1021653654 7:22854365-22854387 CTGCCCCCACGCCGAGGCCTCGG + Intergenic
1022060763 7:26792174-26792196 CTGCCTCCACACCCAGCCCCTGG - Intronic
1022605245 7:31806784-31806806 CTACCCCTAGACCAATCCCTGGG - Intronic
1023039669 7:36161121-36161143 AAGTCCCCAGAGCAAGCCCTGGG - Intronic
1023542186 7:41277454-41277476 CTTCTCCCAGACCAAGTCCAAGG + Intergenic
1024094743 7:45974666-45974688 CTGAGCCCAGCCCACGCCCTCGG + Intergenic
1024731304 7:52256544-52256566 TTCCCCCCAGCCCAAGCCCATGG + Intergenic
1027577860 7:79953413-79953435 ATAACCCCAGACCTAGCCCTTGG + Intergenic
1029460023 7:100689086-100689108 TTCTCCCCAGACCAAGCCCCTGG - Exonic
1029518991 7:101048134-101048156 CTTCCCCCACCCCATGCCCTGGG + Intronic
1029548208 7:101222436-101222458 CTCCTCCCGGGCCAAGCCCTGGG - Intronic
1030049027 7:105521982-105522004 CTGGCCCCAGCCCCAGCCCCAGG - Intronic
1031142431 7:117958107-117958129 CTGCCCAAAGACCAAGACTTGGG - Intergenic
1031180127 7:118403579-118403601 CTCTCCCCAGAACAAGCCTTTGG + Intergenic
1032069450 7:128794775-128794797 CTCCCTCCAGTCCAAGTCCTGGG - Intronic
1032482439 7:132257613-132257635 GTGTCCCCAGACCATACCCTTGG - Intronic
1034193642 7:149229512-149229534 CAGCCCCCAGCACAGGCCCTAGG + Intergenic
1035047018 7:155974294-155974316 CAGCCTGCAGACCCAGCCCTGGG - Intergenic
1035174801 7:157042725-157042747 CTGACTCCAGTCCCAGCCCTAGG + Intergenic
1035404478 7:158588420-158588442 CTGGCCCCAGCCCACGCCCTGGG - Intergenic
1036630620 8:10511700-10511722 CTTCCCCCATACCTTGCCCTGGG - Intergenic
1037829453 8:22179185-22179207 CTGCAGCCAGACCAAGCCCCGGG - Intronic
1040765405 8:50903902-50903924 CTTCACCAAGACCGAGCCCTGGG - Intergenic
1041193363 8:55375478-55375500 CTCAGCCCAGACCAAGACCTTGG - Intronic
1041194511 8:55387499-55387521 CTGACCACAGCCCTAGCCCTAGG - Intronic
1041766453 8:61423172-61423194 CTGCCCCCACCTCAACCCCTGGG + Intronic
1044730547 8:95225567-95225589 CAGCCCCCAGGCCAAGCCCCAGG - Intergenic
1047118193 8:121869278-121869300 AGGCCCCCAGCCCAAGTCCTTGG + Intergenic
1048204943 8:132407857-132407879 CAGCCCCCAGACCACATCCTGGG + Intronic
1048950149 8:139489890-139489912 CTTCCCCCTGACAAAGCCCCTGG + Intergenic
1049016106 8:139921260-139921282 CTGCCCTCAGATCTGGCCCTGGG - Intronic
1049019984 8:139949727-139949749 CTTCCCCCACCCCCAGCCCTAGG - Intronic
1049432813 8:142573180-142573202 CTCCCACCAGGCCCAGCCCTGGG + Intergenic
1049989975 9:981561-981583 CAGCCCCAAGAGCCAGCCCTGGG - Intronic
1050461038 9:5877560-5877582 CTGGCCCCTGCCCAAGCCCATGG - Intergenic
1052970423 9:34373911-34373933 CTCCCTCCAAACCAGGCCCTGGG - Intronic
1053464947 9:38299126-38299148 CTGGCCCCAGACCCAGGCCCTGG + Intergenic
1055915481 9:81396120-81396142 CTAGCCCCAGACTAAGCTCTGGG + Intergenic
1056676416 9:88680391-88680413 CTGTGCCCAGCCCACGCCCTTGG + Intergenic
1056814528 9:89791873-89791895 CTGCTCCCAGCCCAGGCCCCAGG + Intergenic
1057553993 9:96073025-96073047 CAGCCCCCAGCCCACTCCCTGGG + Intergenic
1058088819 9:100781127-100781149 CTGACCCCACAGCAGGCCCTGGG - Intergenic
1058645947 9:107131544-107131566 CTGCCCCGTGACCAGGCCCTGGG + Intergenic
1059217699 9:112581552-112581574 CTGCACCCAGATCTGGCCCTGGG - Intronic
1059691563 9:116689771-116689793 TTGCCCTTAGACCAAGACCTGGG + Intronic
1060476073 9:123987798-123987820 CTGTCCACTGACCAAGCCATAGG + Intergenic
1060665248 9:125428694-125428716 CTGGCCCCTCCCCAAGCCCTTGG - Intergenic
1060718459 9:125956607-125956629 CAGCCACCAGACCAAGCCTCTGG - Intronic
1061227854 9:129291112-129291134 CCGCGCCTAGACCAGGCCCTGGG - Intergenic
1061639957 9:131945589-131945611 CAACCCCCATGCCAAGCCCTTGG + Intronic
1061874572 9:133537327-133537349 CTGCCCCCACCCCATGCCCGAGG - Intronic
1061894622 9:133640806-133640828 CTGCCTCCTGACCAAACCCAGGG - Intronic
1061976274 9:134069440-134069462 CTGCACCCACCCCAAGCCCCTGG + Intergenic
1062035333 9:134380295-134380317 CTGCCCCCAGGCCAAGCCACGGG - Intronic
1062192150 9:135253560-135253582 GTGCCCCCAGACCAAGCATCAGG - Intergenic
1062284622 9:135767570-135767592 CTGCACCCCAACCCAGCCCTGGG + Intronic
1062626621 9:137445953-137445975 CAGCCCCCAGACCACACCCCAGG + Intergenic
1062723754 9:138059368-138059390 CTGCCCCCAGCCTAGGTCCTGGG + Intronic
1187575772 X:20553080-20553102 CTTCCCCCACACCCAGCCCCTGG + Intergenic
1189153733 X:38733834-38733856 CTGCCCCCATCCCAAACCCATGG - Intergenic
1191640457 X:63426033-63426055 CAGCCCCAAGGCCAAGCCCCTGG - Intergenic
1191846736 X:65552346-65552368 CTGCCCCTCCACCAAGCCCACGG + Intergenic
1192119007 X:68437424-68437446 CTGCCTCGACCCCAAGCCCTGGG + Intergenic
1192201489 X:69069203-69069225 CTGCCACCTGCCCAAGCCCAGGG + Intergenic
1192503254 X:71666638-71666660 GTGCCCCCAGATCGAGGCCTCGG + Intergenic
1193820022 X:86149494-86149516 CAGCCCCCAGAGAAAGCCCTTGG - Intronic
1195122992 X:101775370-101775392 AAGCCCCCATTCCAAGCCCTAGG - Intergenic
1196777299 X:119351024-119351046 GTGGACCAAGACCAAGCCCTTGG + Intergenic
1197079258 X:122393087-122393109 CTGTCCCCAGCTCAAGGCCTGGG + Intergenic
1197867562 X:131035325-131035347 AATCCCCCAGACCTAGCCCTTGG - Intergenic
1198049034 X:132930691-132930713 CTTTCCCCAAGCCAAGCCCTTGG - Intronic
1199540807 X:148956066-148956088 CTGCCCACAAACCAGCCCCTAGG + Exonic
1199990603 X:152985618-152985640 CTGTCCTCAGACCCATCCCTGGG - Intergenic
1200033692 X:153315092-153315114 CTGTCCTCAGACCCATCCCTGGG - Intergenic
1200043203 X:153384739-153384761 CTCCTCCCAGCCCCAGCCCTTGG - Intergenic
1201575370 Y:15456436-15456458 CTGCCCCCAGGCGAGGGCCTCGG - Intergenic