ID: 1185313725

View in Genome Browser
Species Human (GRCh38)
Location 22:50170183-50170205
Sequence CTGCGTGGCGGGGGGCGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185313712_1185313725 27 Left 1185313712 22:50170133-50170155 CCTTTCATTTCATTTCAATATTT No data
Right 1185313725 22:50170183-50170205 CTGCGTGGCGGGGGGCGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185313725 Original CRISPR CTGCGTGGCGGGGGGCGGGG TGG Intergenic
No off target data available for this crispr