ID: 1185313847

View in Genome Browser
Species Human (GRCh38)
Location 22:50170500-50170522
Sequence GAGTAGCCGGAGGCGCGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185313847_1185313859 8 Left 1185313847 22:50170500-50170522 CCGCCGCGCGCCTCCGGCTACTC 0: 1
1: 0
2: 2
3: 5
4: 123
Right 1185313859 22:50170531-50170553 CGGAGCCCCCCGCTCGGTCCCGG 0: 1
1: 0
2: 2
3: 7
4: 106
1185313847_1185313854 2 Left 1185313847 22:50170500-50170522 CCGCCGCGCGCCTCCGGCTACTC 0: 1
1: 0
2: 2
3: 5
4: 123
Right 1185313854 22:50170525-50170547 ATCCCCCGGAGCCCCCCGCTCGG 0: 1
1: 0
2: 0
3: 6
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185313847 Original CRISPR GAGTAGCCGGAGGCGCGCGG CGG (reversed) Intergenic
900545591 1:3227417-3227439 GAGTTGACGGAGGCCCGTGGGGG - Intronic
904296329 1:29521872-29521894 GAGCAGCCGGAGGCACGTTGTGG + Intergenic
904409995 1:30319573-30319595 GAGCAGCCGGAGGCACGCTGTGG - Intergenic
906805602 1:48776650-48776672 CAGTCGCGGGGGGCGCGCGGGGG + Exonic
908132183 1:61083788-61083810 GAGCGGCCGGAGTCGCGCGGTGG - Intronic
908534762 1:65067165-65067187 GGGTAGGCGGCGGAGCGCGGGGG - Intergenic
912776592 1:112509487-112509509 GAGAGGCCGGAGGCGCCTGGAGG + Intronic
922496745 1:226063057-226063079 GAGGAGCCAGGGGCGCGGGGAGG - Intronic
924436618 1:244048771-244048793 TGGCAGCCGGAGGAGCGCGGCGG - Intergenic
924527149 1:244863306-244863328 GAGGAGCCGCGGGCGGGCGGCGG - Intronic
1064086536 10:12349774-12349796 GAGCGGCCGGGGGCGCGCTGGGG - Exonic
1065025076 10:21534051-21534073 GGGGAGCCGGCGGCGCGCGGAGG - Intergenic
1065483850 10:26217862-26217884 GAGAAGCCGGCGGAGAGCGGCGG + Exonic
1069760718 10:70809319-70809341 GGGTAGCCGGGGGCGGGGGGGGG - Intergenic
1070025219 10:72625876-72625898 AAGTAGCCGGATGCCCGGGGCGG + Intronic
1070800753 10:79243272-79243294 GATGGGCCGGGGGCGCGCGGGGG - Intronic
1071603167 10:86968817-86968839 GAGGAGCCGGAGCTGCGCTGCGG + Intronic
1074495298 10:113975013-113975035 GAGTAGTCGGCCGGGCGCGGCGG - Intergenic
1074765078 10:116694637-116694659 GAGGAGCCGTAGGGGCTCGGGGG - Intronic
1075645354 10:124092959-124092981 GGATAGCCGGAGGCCGGCGGGGG - Intronic
1078317037 11:10302921-10302943 CAGCAGTCGGAGGCGCGCGCGGG + Intergenic
1083554442 11:63614474-63614496 CATTAGCCGGCGGCGCGGGGAGG - Intronic
1083766712 11:64844813-64844835 GTGGGGGCGGAGGCGCGCGGGGG + Intergenic
1084000904 11:66294997-66295019 GACTATCTGGAGGCGCGCGAGGG + Exonic
1087857433 11:103109383-103109405 GCGTCGCTGGCGGCGCGCGGTGG - Intergenic
1089499921 11:118925840-118925862 GGGGAGGCGGCGGCGCGCGGCGG - Intronic
1090749138 11:129730748-129730770 GAGTAGCCGCAGGAGAGTGGTGG + Intergenic
1092262054 12:6958180-6958202 GAGAAGCCGGGGGTGAGCGGAGG - Intronic
1093547783 12:20368848-20368870 GAGGAGCCGGGGGCGCAGGGCGG - Intergenic
1097218150 12:57430508-57430530 GAGAAGCTGGGGGCGCGGGGCGG - Intronic
1097281355 12:57846812-57846834 GAGAGCCGGGAGGCGCGCGGGGG - Intergenic
1103555784 12:121765771-121765793 GAGGAGCTGGAGGAGGGCGGAGG - Intronic
1104882769 12:132084128-132084150 GCGGAGCCAGAGGCGCGCGCCGG + Intergenic
1125553458 15:40565151-40565173 GAGCAGCAAGAGGCGAGCGGTGG + Intergenic
1125577316 15:40764472-40764494 CAGGAGCCGGAAGCGCCCGGAGG - Intronic
1127071175 15:55289681-55289703 GAGGAGCGGGAGGCGCGCGGCGG - Intronic
1129644812 15:77420140-77420162 GAGCGGCCGGGAGCGCGCGGTGG - Exonic
1131035251 15:89217894-89217916 GAGCTGCCTGAGGCGCACGGAGG - Intronic
1132055634 15:98648841-98648863 GAGCAGGCGGCGGCGGGCGGGGG + Intergenic
1135296456 16:21283703-21283725 AAGGTGCCGGGGGCGCGCGGAGG - Intronic
1135321725 16:21502013-21502035 GAGGAGGCGGCGGCGGGCGGGGG + Intergenic
1135437243 16:22437252-22437274 GAGGAGGCGGCGGCGGGCGGGGG - Intergenic
1135842337 16:25887982-25888004 GTGTAGCGGGACGGGCGCGGTGG - Intronic
1136284123 16:29231367-29231389 GAGCAGCCGGGGGCGGCCGGAGG - Intergenic
1136366646 16:29812116-29812138 GAGGGGCCGGAGGCTCGCGAGGG + Intronic
1138265283 16:55656021-55656043 GAAGAGCTGGAGGCGCGGGGCGG - Intronic
1138619125 16:58197845-58197867 GAGGAGGAGGAGGAGCGCGGCGG + Exonic
1141131616 16:81441451-81441473 GAGTAGCAGGAAGGGCACGGCGG - Intergenic
1141873984 16:86809011-86809033 GAGCAGCAGGAGGTGAGCGGAGG - Intergenic
1142089157 16:88200876-88200898 GAGCAGCCGGGGGCGGCCGGAGG - Intergenic
1142335777 16:89489470-89489492 GGGTTGCAGGAGGCGCGCGTAGG - Intronic
1142335913 16:89489876-89489898 GGGTGGCCGGGGGCCCGCGGCGG - Intronic
1142812227 17:2400721-2400743 GAGCTGCCGGGGGCGCGCCGGGG + Exonic
1143520289 17:7440694-7440716 GGGCAGCCGGTGGCGCGGGGAGG - Intronic
1145243663 17:21253597-21253619 AAGTAGCCGGCGCGGCGCGGCGG - Intergenic
1148880540 17:50722481-50722503 GAGGAGCCGGCCGGGCGCGGTGG - Intronic
1150002833 17:61452216-61452238 GAGGAGCCGGCGGCTCGCGTGGG + Intergenic
1152121540 17:78421894-78421916 GAGCAGCGGGCGGCGGGCGGCGG + Intronic
1152760784 17:82106039-82106061 GAGTAGCCACAGGCGCCCAGAGG - Intronic
1153893031 18:9535794-9535816 GAGGAGCCTGAGTGGCGCGGGGG + Exonic
1160864535 19:1251002-1251024 GTGTCCCCGGAGGCCCGCGGGGG - Intronic
1161194678 19:2979800-2979822 GTGTTGCCGGGGGCGGGCGGGGG + Intronic
1163666626 19:18606664-18606686 GCGCTGCCGGGGGCGCGCGGCGG + Exonic
1163667732 19:18610974-18610996 GAACAGCAGGAGGGGCGCGGGGG + Intronic
1165595398 19:37008201-37008223 GAGTTGCCTGGGGCGGGCGGGGG + Intronic
1166831047 19:45639704-45639726 GAGTACCCGGCCGGGCGCGGTGG + Intronic
1167112847 19:47472019-47472041 GAGGAGGCGGAGGCGGGCAGAGG + Exonic
1167551348 19:50163034-50163056 GAGCAGCTGCAGGCGCGCGCCGG - Exonic
926216946 2:10911779-10911801 GAGGGGCCGGCGGTGCGCGGTGG + Intergenic
927139140 2:20118036-20118058 GAGGAGCAGGAGGAGCCCGGAGG + Intergenic
927139164 2:20118120-20118142 GAGGAGCAGGAGGAGCCCGGAGG + Intergenic
931602499 2:64018897-64018919 GAGTGGGCTGAGACGCGCGGGGG + Intronic
933847479 2:86337442-86337464 GAGGGGACGGAGGGGCGCGGGGG + Intronic
935150108 2:100426521-100426543 GAGGAGCCCGAGTGGCGCGGAGG + Intergenic
935463063 2:103361913-103361935 GAGGAGGCGGAGGCGGGAGGAGG - Intergenic
935463069 2:103361929-103361951 GAGGAGGCGGAGGCGGGAGGAGG - Intergenic
936872410 2:117148430-117148452 GAGTGCCCGGAGGCGGGGGGAGG - Intergenic
938157309 2:128952392-128952414 GAGTAGTAGGAGGCAGGCGGAGG - Intergenic
943669834 2:190648983-190649005 GAGGCGGCGGAGGCGGGCGGGGG + Intronic
948600714 2:239106169-239106191 GAGGAGCCGAGGGCGGGCGGAGG + Intronic
949070359 2:242020779-242020801 GTGTAGCTGGAGGCGCGGTGGGG + Intergenic
1172385012 20:34528023-34528045 GAGTAGCCGGCCGGGCGCGGTGG + Intronic
1174747738 20:53080714-53080736 GAATAGCAGGAGGTGAGCGGTGG - Intronic
1178894759 21:36549305-36549327 CAGTAGCCGGAGGGGGGCAGGGG - Intronic
1179656831 21:42850978-42851000 GAGTCGCTGGAGGGGCGGGGAGG - Intronic
1182257759 22:29050531-29050553 GAGAAGCAGGTGGCCCGCGGGGG + Exonic
1184241039 22:43211372-43211394 ATGTGGCCGGAGGCGTGCGGGGG + Intronic
1185313847 22:50170500-50170522 GAGTAGCCGGAGGCGCGCGGCGG - Intergenic
952740297 3:36728255-36728277 GAGAAGCCAGAGGCGAGCTGGGG - Intronic
954632749 3:52056161-52056183 GAGGAGCTGGAGGCGCGCGGCGG - Exonic
961754915 3:129121829-129121851 GCGGAGCCGGGGGCGGGCGGGGG - Intronic
964771121 3:160225443-160225465 GAGGAGCCCGCGGCGCGCGGAGG - Intergenic
969113885 4:4859759-4859781 GAGGGGCGGGAGGCGCGCGCGGG + Exonic
969330340 4:6470988-6471010 GCGGAGCCGGAGCCCCGCGGAGG - Intronic
972205427 4:36766260-36766282 GAGTAGCCTGAGGCGAGTTGAGG + Intergenic
973613676 4:52659299-52659321 GAGGAGGCGGCGGCGCGGGGAGG + Exonic
985512473 5:320607-320629 GAACAGCAGGAGGCGCGGGGCGG + Intronic
985896380 5:2751851-2751873 GAGGCGACGGAGGCGGGCGGCGG + Intergenic
986044441 5:4023603-4023625 GAGGAGCAGGACGCGCGTGGAGG + Intergenic
988722463 5:33892218-33892240 GCGGGGCCGGAGGAGCGCGGGGG - Intergenic
989570774 5:42944226-42944248 GAGTAGCCGCAGGCGCCCTCTGG + Intergenic
995650052 5:114360970-114360992 GAGCAGCTGGAGGCCGGCGGTGG + Exonic
998374602 5:141682302-141682324 GAGTGGCCGGGGCCCCGCGGAGG - Intergenic
1003898675 6:10632592-10632614 GAGAAGGCGGCGGGGCGCGGTGG + Intergenic
1004658370 6:17686874-17686896 GGGCAGCCGGGGGCGGGCGGCGG + Intronic
1006671460 6:35732032-35732054 CCGTCGCCGGATGCGCGCGGGGG + Intergenic
1006717612 6:36130476-36130498 GAGGAGCGGGCGGCGCGGGGCGG + Exonic
1008956547 6:57222047-57222069 GAGGAGCCGGTGGCGCCGGGCGG - Exonic
1017073958 6:150600513-150600535 GAGGACCCGGGGACGCGCGGTGG + Intronic
1017164203 6:151391734-151391756 CAGGAGGCGGAGGCGGGCGGGGG - Intergenic
1019055778 6:169222288-169222310 GAGTAGCCATAGGCCCGCGTGGG + Exonic
1019893865 7:3967814-3967836 GCGTAGCAGGAGGTGAGCGGTGG - Intronic
1025069709 7:55887696-55887718 GAGGAGGCGGAGGCGGGAGGCGG + Intronic
1031586193 7:123534645-123534667 GAGGAGCCAGAGGCGGGTGGGGG + Intronic
1034255168 7:149720790-149720812 GAGCAGCCGCAGGGGTGCGGGGG + Intronic
1034412290 7:150947798-150947820 GAGTAGCCGGGGCCGGCCGGGGG - Exonic
1034474326 7:151274019-151274041 GAGGAGCCTGAGGCTCGGGGAGG - Intronic
1034680691 7:152925480-152925502 GAGGGGCCGGGCGCGCGCGGGGG + Intergenic
1034967423 7:155399958-155399980 GAGGAGACGGAGGCGCACAGAGG - Intergenic
1049194666 8:141308582-141308604 GCGTAGCGGGAGGAGGGCGGGGG - Intergenic
1049623531 8:143609854-143609876 GAGAGGCCGGAGGAGCGGGGAGG + Intergenic
1060389880 9:123268499-123268521 GAGGAGCCGGAGACGCGAGCGGG - Intronic
1060980042 9:127786412-127786434 GAGGAGCCTGAGGCCCGTGGTGG + Intronic
1061727401 9:132589384-132589406 GAGCAGGCGGCGGCGCGCTGGGG - Exonic
1062037034 9:134386942-134386964 GTGTAGCCGGAGGGGTGCAGTGG + Intronic
1189473658 X:41333322-41333344 GGGGAGCCGGCGGCGCGCGCAGG - Intergenic
1189821554 X:44873681-44873703 GAGGAGAGGGAGGCGCTCGGCGG + Exonic
1192363818 X:70455097-70455119 GAGACGCCTGAGGCGCGCGATGG - Intronic
1197389907 X:125848962-125848984 TAGGAGCCGGTGGGGCGCGGTGG - Intergenic
1199759992 X:150898306-150898328 GAGTAGCCGGAGAGGAGGGGTGG - Intronic
1201904493 Y:19076077-19076099 GGGTTGCTGGAGGCGCGCGTAGG - Intergenic