ID: 1185314003

View in Genome Browser
Species Human (GRCh38)
Location 22:50170963-50170985
Sequence GCGCCCCGCGCCCCGGCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 629
Summary {0: 1, 1: 0, 2: 15, 3: 78, 4: 535}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185314003_1185314013 7 Left 1185314003 22:50170963-50170985 CCGGCGGCCGGGGCGCGGGGCGC 0: 1
1: 0
2: 15
3: 78
4: 535
Right 1185314013 22:50170993-50171015 GGGGGCGTCCGCAGGTGTCCGGG 0: 1
1: 0
2: 1
3: 14
4: 151
1185314003_1185314011 -1 Left 1185314003 22:50170963-50170985 CCGGCGGCCGGGGCGCGGGGCGC 0: 1
1: 0
2: 15
3: 78
4: 535
Right 1185314011 22:50170985-50171007 CGGGCAGAGGGGGCGTCCGCAGG 0: 1
1: 0
2: 0
3: 10
4: 184
1185314003_1185314014 13 Left 1185314003 22:50170963-50170985 CCGGCGGCCGGGGCGCGGGGCGC 0: 1
1: 0
2: 15
3: 78
4: 535
Right 1185314014 22:50170999-50171021 GTCCGCAGGTGTCCGGGAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 150
1185314003_1185314012 6 Left 1185314003 22:50170963-50170985 CCGGCGGCCGGGGCGCGGGGCGC 0: 1
1: 0
2: 15
3: 78
4: 535
Right 1185314012 22:50170992-50171014 AGGGGGCGTCCGCAGGTGTCCGG 0: 1
1: 0
2: 1
3: 13
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185314003 Original CRISPR GCGCCCCGCGCCCCGGCCGC CGG (reversed) Intronic
900100651 1:960750-960772 GCGCCTCGGGCCCGGGCCCCGGG - Exonic
900189939 1:1349106-1349128 GCGCCCCGCGTCCGAGCCCCGGG - Exonic
900207989 1:1439743-1439765 GTGCCCCGCGCCCCGACCCCGGG + Exonic
900237565 1:1600016-1600038 GCGCCCCGTGGCCCCGCCGCAGG - Exonic
900245525 1:1634432-1634454 ACGCCCCGCCCCCCTGCAGCTGG + Exonic
900256754 1:1701589-1701611 ACGCCCCGCCCCCCTGCAGCTGG + Intronic
900349260 1:2227251-2227273 CCGCCCCGCCCGCCGGCCCCTGG - Intergenic
900366709 1:2314657-2314679 GGGCCCCGCGCCGCGTCCTCAGG + Intergenic
900438766 1:2643222-2643244 GCGCCCCGCCCCTCGGCAGGCGG - Intronic
900647859 1:3717185-3717207 GCTCCTCGCTCCCCGGCAGCTGG - Intronic
900786902 1:4655160-4655182 GAGCCCCGCGCCCCGGCCGGAGG + Exonic
901086176 1:6613657-6613679 GCGCCACGCCCCCTCGCCGCTGG + Intronic
901086549 1:6614743-6614765 GGCCCCCGCCCCCCGCCCGCGGG + Intronic
901131356 1:6963728-6963750 GCGCCCAGCCCCCAGGCCCCGGG - Intronic
901676523 1:10888870-10888892 TCGCCCCGCCCGCCGGCAGCTGG - Intergenic
902169598 1:14599154-14599176 GCGGCCAGCGCCTCGGCGGCGGG + Exonic
902286123 1:15409814-15409836 GCGCGCCCCGCCCCCGCCCCCGG - Intergenic
902286248 1:15410309-15410331 CCGCCCCGCGACCCGGTCTCGGG + Intronic
902535965 1:17119481-17119503 CCGCCCCGCCCACCGGCCGCTGG - Intergenic
903164124 1:21509272-21509294 GAGCCCCGCGCCCCGCGGGCCGG - Intergenic
903263387 1:22142999-22143021 GCGCGCCCCGGCCCGCCCGCGGG - Intronic
903466381 1:23554954-23554976 GCGCCCCACGCTCCCCCCGCGGG - Intergenic
904696840 1:32335864-32335886 GCGGCCCCGGCCCCGGCCCCGGG + Intronic
905037878 1:34929487-34929509 GCGCCCCCGGCCCGGGCCGCCGG - Exonic
905212671 1:36385534-36385556 GCAGCCCTCGCCCCTGCCGCCGG + Intronic
905819855 1:40980417-40980439 GCGCCCCGACCCCCGGCCGCCGG - Intronic
906047912 1:42846814-42846836 GCGACCCTCGCCCTGGCCCCCGG + Intronic
906087375 1:43147761-43147783 TCGCCCCGCCCCGCGCCCGCCGG - Intronic
906102612 1:43272806-43272828 GCGCCGAGCGCCGCGGCTGCTGG - Exonic
906495783 1:46303053-46303075 CCCCCGCGCCCCCCGGCCGCTGG + Intronic
906524335 1:46485747-46485769 GCGGCCCGCGGCCGGGCCCCCGG + Intergenic
906680948 1:47725205-47725227 GCGCCGCGCGCTCCGGCCGCTGG - Intergenic
907189072 1:52633556-52633578 CCGCCTCGCCCCCCGGCCGCGGG - Exonic
911219718 1:95234114-95234136 GCGCCCCGCGCCTCCGCAACCGG - Intronic
912532757 1:110338503-110338525 GAGCCCCGCCCCCCGCGCGCGGG - Exonic
914013105 1:143794016-143794038 GCGCACCGCGCACCTGCCCCCGG - Intergenic
914164721 1:145167169-145167191 GCGCACCGCGCACCTGCCCCCGG + Intergenic
914197395 1:145454552-145454574 GCGCCCCGCGCCCTCCCTGCCGG - Intergenic
914651729 1:149702625-149702647 GCGCACCGCGCACCTGCCCCCGG - Exonic
915070348 1:153261155-153261177 GCCGCCCCCGCCCCCGCCGCCGG - Exonic
915070490 1:153261674-153261696 GCTCCCGCCGCCCCCGCCGCTGG - Exonic
915213350 1:154325630-154325652 GCGCCCCCCGCCCCAGCCCCCGG + Intronic
915617029 1:157046361-157046383 GCGCCCCGTGCCCCTGCCCACGG + Intergenic
916651647 1:166839574-166839596 CCACCCCGCGCCCTGGCCGCTGG + Intronic
918094817 1:181325874-181325896 GCGCTCCCCTCCCAGGCCGCAGG + Intergenic
920331510 1:205211558-205211580 GCGGCTCGGTCCCCGGCCGCAGG + Exonic
922250655 1:223846022-223846044 CCGCCCCTCCCCCAGGCCGCCGG - Intergenic
922335840 1:224617495-224617517 GCGTCCCGGGTCCCGGGCGCCGG + Intronic
922739401 1:228006944-228006966 TCGGCCCGCAGCCCGGCCGCCGG + Intergenic
922925392 1:229343030-229343052 GCGGCCCGCGCTCCAGCTGCAGG + Intronic
923141198 1:231162574-231162596 GCGCACAGCAGCCCGGCCGCTGG + Intronic
924502806 1:244653005-244653027 GCGCCAGGCGCCCCGGGGGCGGG - Exonic
924948098 1:248859147-248859169 GTGCCCCGCGCAACGCCCGCCGG + Intergenic
1064231019 10:13529142-13529164 GCGCCGCGCGGCCAGGCCGGCGG - Intergenic
1064392467 10:14953858-14953880 GCCCCCAGCGCCCCGGGAGCGGG + Intronic
1064443190 10:15371322-15371344 GCTGCCCGCGCCCAGGCCCCGGG + Intergenic
1065025317 10:21534891-21534913 CCGCCCCGTGCCGCGGCCGCGGG + Intronic
1066370376 10:34814717-34814739 GCGCCCCCCGCCCCGGACTGCGG - Intronic
1069673890 10:70233431-70233453 GCGCTCCCCGCCCCGCCCGCCGG - Intronic
1069738360 10:70672380-70672402 GCGCCCCGCCCCCGGGCGCCCGG + Intergenic
1070895846 10:79982374-79982396 GCTCCCCACGGCCCCGCCGCGGG - Intronic
1071857974 10:89645076-89645098 GCGCCCTGCCCCCCGCGCGCCGG + Exonic
1072591428 10:96832096-96832118 CCGCCCCGCGCGCCGCCCGCCGG - Intergenic
1072809329 10:98446898-98446920 GCGCACAGCGCCCCGCCTGCAGG + Exonic
1073265630 10:102226686-102226708 CCCCCTCGCGCCCCGGCCCCGGG - Intronic
1074503116 10:114043980-114044002 GCGCCCGGCGCCCATGCCTCCGG + Intergenic
1074591855 10:114821679-114821701 GCGCCTAGCGGCCCCGCCGCAGG + Intergenic
1075031949 10:119029763-119029785 GCGCGCCGCCTCCCCGCCGCCGG - Exonic
1075054314 10:119206857-119206879 GCGCCGCGCACCGCGGCCGGCGG + Intergenic
1075129534 10:119726210-119726232 ACGCCCCGTGCGCCGCCCGCGGG + Exonic
1075522470 10:123151197-123151219 GCGCCCAGCTACCCGGCCGGTGG + Intergenic
1075697550 10:124447900-124447922 GCTCCCCGCGTCCCAGGCGCCGG - Exonic
1076137860 10:128057239-128057261 ACGCCCCGCCCCCCTGCTGCTGG - Intronic
1076650148 10:131981929-131981951 GAGCCCCGCAGCCCGGCCGGAGG + Exonic
1076868919 10:133183168-133183190 GCCGCCCGCGCCCACGCCGCTGG - Intronic
1076878757 10:133230122-133230144 GCGCGCCCCGCCCCGCCCGCCGG - Intergenic
1076878800 10:133230266-133230288 GCGCGCCGCGCCCCAGCCCCGGG + Exonic
1077021026 11:417233-417255 GCGCCCCGGGCCCCGACTCCAGG + Intronic
1077093533 11:789991-790013 GCCCCGCCCGCCCCGCCCGCCGG + Intronic
1077204943 11:1337502-1337524 GCGCCCCCCGCCCCCGCCTCGGG - Intergenic
1077404671 11:2377698-2377720 GCGGCCCGCGCTGCGCCCGCGGG - Intronic
1077441112 11:2569675-2569697 GAGCCCAGCGCCCAGGCAGCCGG - Intronic
1077491478 11:2862799-2862821 GCTTCCCGGGCCCGGGCCGCTGG - Intergenic
1080503674 11:32892863-32892885 TCGCCGCGAGTCCCGGCCGCGGG + Intergenic
1080517650 11:33039194-33039216 GCGCGCCGCATCCCAGCCGCTGG - Intergenic
1081851489 11:46277935-46277957 GCGCCCCGCGCCCCCCACCCGGG + Exonic
1081863543 11:46347586-46347608 GCGTGCTGAGCCCCGGCCGCCGG + Intronic
1082238602 11:49850595-49850617 GCGCCCCGCCACCCTGCGGCTGG - Intergenic
1082243544 11:49893735-49893757 GCGCCCCGCCACCCTGCAGCTGG + Intergenic
1083572592 11:63768448-63768470 GGGGCCCCCGCCCGGGCCGCCGG + Intronic
1083766683 11:64844747-64844769 GCGCCCCGCCCCCCGACGGACGG + Intergenic
1083901771 11:65646789-65646811 GCGCGCGGCGCCCGGGGCGCGGG + Exonic
1084172962 11:67409487-67409509 GGGACCCCCGCCCCGGCCACAGG + Exonic
1084174287 11:67415601-67415623 CCGCCCCGCGCCGCCCCCGCTGG + Intronic
1084192170 11:67504274-67504296 GAGCCCTGCGCGCCGGCCGAGGG + Intronic
1084192481 11:67505258-67505280 GCGCCCCCAGCCCCGGCCTCGGG + Exonic
1084273031 11:68039085-68039107 GCGCGCCGCGCCTCCGCTGCTGG - Exonic
1084621105 11:70270779-70270801 CCGCCCCACGCCGCGGCCCCGGG - Exonic
1084621210 11:70271141-70271163 GCGCCCCGTGACCCGGGCGCTGG + Intronic
1084804764 11:71571302-71571324 GTGCCCCAGGCCCCGGCGGCGGG - Intergenic
1084805691 11:71577221-71577243 GTGCCCCAGGCCCCGGCGGCGGG + Intergenic
1084833640 11:71787607-71787629 GCGCCCTGCGCTCCTTCCGCTGG + Exonic
1084956162 11:72692761-72692783 GGGCCCCGCTCCACGGCCTCTGG + Exonic
1085043971 11:73342954-73342976 GAGCGCTGCGGCCCGGCCGCCGG - Intronic
1085266490 11:75240806-75240828 TCGCCCTGCGCGCCGGCCTCCGG - Intergenic
1086541556 11:87918057-87918079 GCCCCCCGCCCCCCAGCCTCAGG + Intergenic
1086590410 11:88508824-88508846 GCCGCCTGCGCCCCTGCCGCGGG + Exonic
1086697969 11:89865555-89865577 GCGCCCCGCCACCCTGCGGCTGG + Intergenic
1086708193 11:89978933-89978955 GCGCCCCGCCACCCTGCGGCTGG - Intergenic
1087141290 11:94768318-94768340 GCTCCCCGCTCCCCGCGCGCGGG - Intronic
1088279487 11:108121766-108121788 AAGCCGCGCGCCCGGGCCGCGGG - Intronic
1088495735 11:110430002-110430024 GCGCCCCTCGCCGCGGCCCTCGG + Exonic
1088630132 11:111766413-111766435 CCGCCCCGCGCCCAGGCAGTAGG + Intronic
1089078855 11:115760098-115760120 GCGCCCAGCGCCCCCGCCGCGGG + Intergenic
1089540680 11:119187625-119187647 GCCCCCCGGGGCCCGGCTGCTGG + Exonic
1089622221 11:119728681-119728703 GCCCACCCCGCCCCGGCCGACGG - Exonic
1090784970 11:130040807-130040829 GCGAACCTGGCCCCGGCCGCGGG - Intergenic
1091460898 12:642944-642966 ACGCCCCACGCCGCGCCCGCCGG + Intronic
1091759369 12:3077173-3077195 GGGCCCCGTGCCCCGTCCCCGGG + Intergenic
1092159989 12:6310792-6310814 GCGCCGCCCTCCCCGCCCGCGGG - Intronic
1092204487 12:6606955-6606977 GCCCCCCGCGTCCCTGCCTCCGG - Intronic
1092861673 12:12724575-12724597 GCGCCCACCGCCCCGGCCTCAGG + Intergenic
1094041715 12:26126122-26126144 GCGCCGAGCGCCGCGGCTGCAGG - Intronic
1094536550 12:31326421-31326443 ACGCCCCCCCCCCCGGCTGCAGG + Intronic
1095440829 12:42237854-42237876 GCGCGCCGCGCTCCGGCTGAGGG + Intronic
1096784420 12:54009068-54009090 GCCGCCCGCGCCCCAGCCCCGGG + Intronic
1097007861 12:55931939-55931961 GCGCCCGGCGCCCCCGACTCTGG - Intronic
1097190401 12:57216806-57216828 GCGCCTCGCGCCCAGTCCGCGGG + Exonic
1097293061 12:57935959-57935981 GTGCCCCGCGGCCCTGCTGCTGG - Intergenic
1097980132 12:65729492-65729514 GCGCCCCGCTCTGCGCCCGCCGG + Intergenic
1098161327 12:67649608-67649630 GCTGCCCGCGCCCCGCCCGTGGG + Intronic
1101466797 12:104957967-104957989 GCTCCCCGCGCCCCCGCCGCCGG + Intronic
1102101500 12:110281715-110281737 CCGCCTCGCACTCCGGCCGCGGG - Exonic
1103509793 12:121466815-121466837 GCGGCGCGCCCCGCGGCCGCCGG + Intronic
1103563257 12:121803625-121803647 GGGCCCCGCGCGCCCGCCTCCGG + Intergenic
1103595982 12:122024370-122024392 GAGCACCGCGCCCTGGGCGCAGG + Intronic
1103828707 12:123762139-123762161 GCAGCCCACGCCCCGGCCCCGGG - Intergenic
1104030859 12:125065252-125065274 CCCCCACGCCCCCCGGCCGCGGG + Intergenic
1104929195 12:132329355-132329377 GCGCGCCGGGCCACGGCCGCCGG + Intergenic
1105004221 12:132711006-132711028 GCGCCCCCCGCCCAGGCCGGCGG - Exonic
1105480793 13:20773686-20773708 GGGCCTCGCGTCCCGGTCGCCGG - Intronic
1106533495 13:30617618-30617640 ACGCCCCACCCCCTGGCCGCTGG + Intergenic
1107787046 13:43968350-43968372 GCGTGCTGAGCCCCGGCCGCCGG + Intergenic
1108648823 13:52455684-52455706 CGGCCCCGAGCCCCGACCGCCGG - Intronic
1110219622 13:73059363-73059385 GGGACCCGTGCCCCAGCCGCCGG + Exonic
1111822286 13:93228145-93228167 GCGCCCGGCGCTCGGGCCGGGGG + Intronic
1112216221 13:97434019-97434041 GCGGGCTCCGCCCCGGCCGCCGG + Intergenic
1112752472 13:102596932-102596954 CCGCCCCTCGCCCCCGCCTCCGG + Intergenic
1113541724 13:111115017-111115039 GCGCCCCGCGCCCCTGGCCGGGG - Intronic
1113660795 13:112105196-112105218 CTGCCCCGCGCCCTGCCCGCGGG - Intergenic
1113942610 13:114026256-114026278 GCTCCCCCCGCCTCGGCTGCTGG - Intronic
1113949966 13:114066388-114066410 GCCTCCCGCTCCTCGGCCGCTGG - Intronic
1114658928 14:24332683-24332705 GCTTCCCGCGCCCCGCCCCCAGG - Exonic
1115545548 14:34462354-34462376 CCCGCGCGCGCCCCGGCCGCCGG + Exonic
1115769965 14:36658050-36658072 TCGCCCCGCGCCCAGGGCGAGGG - Intronic
1117252802 14:53953112-53953134 GCTTCCAGCGCCCCGGCTGCCGG + Intronic
1117315167 14:54566211-54566233 GCGCCCGGAGCGCCGGCCGCGGG - Intergenic
1117478143 14:56118222-56118244 GCGCCCCGCGGGCCGGGGGCGGG + Intronic
1117546554 14:56798287-56798309 GCGACCGGCGCCCCGGCCCGCGG + Intergenic
1118809009 14:69260394-69260416 CCTCTGCGCGCCCCGGCCGCCGG - Exonic
1121253000 14:92513620-92513642 CCGCCCCGAGGCCCGGCCCCGGG + Intergenic
1121648213 14:95535407-95535429 GCGCCCTCCGCCCCGGGCCCAGG + Intronic
1122066039 14:99175093-99175115 GCCCCCCGCGCCCGGGACCCCGG + Exonic
1122221199 14:100239932-100239954 CGGCCGCGCGCCCCGGCCCCGGG + Intronic
1122544955 14:102517099-102517121 ACGCCCAGCGCCCTGGCCCCGGG + Intergenic
1122719963 14:103716242-103716264 GCGCCCCGCACCCCGCCTCCCGG - Intronic
1122736856 14:103848047-103848069 GCCCCCCGCGCCCCTCCCACTGG - Intergenic
1122978562 14:105181088-105181110 GTCCCCCGCGCCCCCGCCGGCGG - Intronic
1123011391 14:105351127-105351149 GTGTCCCGCGCGCCGGCCTCCGG + Intronic
1123041320 14:105491403-105491425 CCGGCCCGGGCCCCAGCCGCGGG - Exonic
1124109417 15:26772843-26772865 GCGCCCTGCCCGCCGCCCGCCGG + Intronic
1124109557 15:26773244-26773266 GCGCCCAGGGCCCCGGCCTCGGG - Intronic
1124922285 15:34038816-34038838 GCGCCCCGCGAGGCAGCCGCCGG - Exonic
1125577909 15:40767645-40767667 GAGCCACGCGCCAGGGCCGCTGG - Exonic
1125678086 15:41513055-41513077 GCGGTCCTCGCCCCTGCCGCTGG - Exonic
1126777609 15:52112809-52112831 CCGCCCCGGCCCCCGGCCCCCGG + Intergenic
1127071256 15:55289915-55289937 GCACCCCGCCCCCCGCCAGCCGG - Intronic
1127606566 15:60592678-60592700 GCGCCCCGCCCCGCCCCCGCGGG + Intronic
1127753421 15:62067985-62068007 CCCGCCCGCGCCCCGGCCCCGGG + Exonic
1127763639 15:62164606-62164628 CCCGCCCGCGCCCCGGCCCCGGG - Exonic
1128067985 15:64775977-64775999 GCACCCAGCGCCCCGGTCCCTGG + Intergenic
1128453628 15:67821210-67821232 GCCCCCCGCGGCCGGGCTGCTGG + Intronic
1129332410 15:74834466-74834488 GCCCCCCTCGCCCCAGCCTCCGG + Intergenic
1131517603 15:93089306-93089328 GGGCCGGGCGCCCGGGCCGCGGG + Intergenic
1131977608 15:97961353-97961375 GCGCCCCGCCCCTGGCCCGCCGG + Intronic
1132055332 15:98647731-98647753 GGGCCCCGCGCCCCGGAAGGGGG - Intergenic
1132370606 15:101295245-101295267 GTGCCCCGCGCCCCGCCGCCAGG + Exonic
1132583108 16:694249-694271 GAGGCCCCCGCCCCGGTCGCGGG - Exonic
1132585771 16:705296-705318 CAGCCCCGCGCCCCGGCCCCTGG - Intronic
1132683511 16:1153183-1153205 GCGCCCCGCGCCCCGCGCCCCGG + Intergenic
1132683808 16:1154046-1154068 GCCCCCCGCCCCCCGCCGGCCGG - Intronic
1132869291 16:2108560-2108582 GCGCTGGGCGCCCCGGCCGCTGG + Exonic
1132885093 16:2179016-2179038 GCGCCCCCCGCCCCGCCCGAAGG - Exonic
1132889448 16:2196643-2196665 CCGCCGCGCGCCCCCGCCCCCGG - Intergenic
1132987759 16:2776964-2776986 GCTCCCCTCGGCCCGCCCGCGGG + Intronic
1133040640 16:3058437-3058459 GCGCCCCGCCCTCCAGCTGCCGG - Exonic
1133241297 16:4416096-4416118 GCGCCCCGAGCCCCGGCTCCCGG + Intronic
1133298763 16:4768888-4768910 GCGCCCCGCGCCCTCCCCGGAGG + Intergenic
1133311291 16:4848071-4848093 GCGGCCCGCGCCTCGGCCCATGG - Intronic
1133784332 16:8963308-8963330 CAGCCCCGGCCCCCGGCCGCAGG - Exonic
1134070268 16:11256078-11256100 GCGTCCCGCGCCCCGCCGCCAGG - Exonic
1134718123 16:16367038-16367060 GCGCCGGGCACCCCGGCCGCTGG - Intergenic
1134956629 16:18385121-18385143 GCGCCGGGCGCCCCGGCCGCTGG + Intergenic
1135382731 16:22008123-22008145 GCGGGCCGCGCCGCGGCTGCTGG + Intronic
1135821972 16:25692705-25692727 GCCGCCCGCGCCGCCGCCGCTGG + Exonic
1136540600 16:30925769-30925791 GCGCTCCGGCCCCCGGCCCCCGG - Exonic
1136707053 16:32200135-32200157 CCGCCCCTCCCCCCGGCCCCTGG - Intergenic
1136760857 16:32729282-32729304 CCGCCCCTCCCCCCGGCCCCTGG + Intergenic
1136807246 16:33141104-33141126 CCGCCCCTCCCCCCGGCCCCTGG - Intergenic
1137412932 16:48244637-48244659 GCGCCGCCCGCCGCCGCCGCGGG - Intronic
1137454815 16:48610096-48610118 GCGCCCCGCCGCCCGCCCTCAGG + Exonic
1137531755 16:49282386-49282408 GCGCCCTGCACCCCGGCCGCCGG - Intergenic
1137605785 16:49786134-49786156 GCTCCCCACGCCCCCGCCTCCGG + Intronic
1137787651 16:51151633-51151655 GGACTCCGCGGCCCGGCCGCCGG + Intergenic
1138514565 16:57528985-57529007 GCCCCCCGCGCCCGCGCTGCTGG - Exonic
1139570106 16:67806462-67806484 GCCCCCAGCGCCCCCGCCGGAGG + Exonic
1140223112 16:73058194-73058216 CGGCCCCGCGCCGCCGCCGCCGG - Intronic
1140927622 16:79599298-79599320 GCGCCGGGCGCGCCGGCCGTCGG + Exonic
1141727453 16:85799347-85799369 GCGCCGCGCGGCCAGGCAGCGGG - Exonic
1141946932 16:87317138-87317160 GCACCCCGCGCCCGGCCCCCCGG + Exonic
1142120421 16:88383917-88383939 GCGCCCCGCGTGGCGGCGGCCGG + Intergenic
1142130787 16:88430656-88430678 CCGCCCGCCGCCCCAGCCGCCGG - Intronic
1142148441 16:88502359-88502381 GTGCCCGGCGCCCGGGCCCCTGG - Intronic
1142374973 16:89701996-89702018 GCCCCAGGCGACCCGGCCGCGGG + Intergenic
1203063009 16_KI270728v1_random:989596-989618 CCGCCCCTCCCCCCGGCCCCTGG + Intergenic
1142558440 17:795434-795456 TCTCCCCTCGCCCCAGCCGCTGG + Intergenic
1142749187 17:1977518-1977540 CCGCCCCCCACCCCGCCCGCCGG + Intronic
1143487159 17:7261455-7261477 GCGCCCCGTGCCCCGCGCCCCGG + Intronic
1143750353 17:9022579-9022601 GCGCGCCGGGGGCCGGCCGCAGG - Exonic
1144338998 17:14297574-14297596 GCCCTTCGCGCCCGGGCCGCTGG + Intergenic
1144756232 17:17682016-17682038 GCGCCCTGCGCCGCGGCTGAGGG + Intronic
1144847055 17:18225574-18225596 GCGCCAGGCGGCCCGGGCGCGGG - Exonic
1145058691 17:19718997-19719019 GCTCCCCCCGCCCCAGCCACAGG - Intergenic
1145094018 17:20009371-20009393 GCGCCCGGAGCCGTGGCCGCTGG + Intronic
1146058691 17:29593534-29593556 GCCCCCCGCCCCGCGGCCCCGGG + Exonic
1146183317 17:30710247-30710269 GCGCGCCGCGCGCCGGCCCCGGG + Intergenic
1146445292 17:32928087-32928109 GCGCCCCGGCCCCCGGCCCCCGG - Exonic
1146445297 17:32928094-32928116 CGCCCCCGCGCCCCGGCCCCCGG - Exonic
1147015674 17:37489830-37489852 GCGCGGCCCGCCCCGGGCGCGGG + Exonic
1147331128 17:39700176-39700198 GCGCCCCGCGCCCTCCCAGCCGG + Exonic
1147742497 17:42676942-42676964 GCGGCCCGGGCCCCGGCCACCGG - Exonic
1147754844 17:42761372-42761394 GCGCCTCCCGCCCGGGCCTCGGG - Intronic
1147793003 17:43025123-43025145 GGGCCCCGCCCCCCGGCTGCGGG + Intronic
1148323705 17:46771703-46771725 GCGCCCCCGGCCCCGGCGCCGGG + Intronic
1148443066 17:47721669-47721691 GGGCCCCACGCCCTGGCCCCAGG - Intergenic
1148452624 17:47789975-47789997 CTGCCCCTCGCCCCGGCCCCAGG + Intergenic
1149470894 17:56914226-56914248 GCGTCCCGCGCCCAGCCCGCGGG - Intergenic
1149610389 17:57954958-57954980 GCCCCCCGCGCCCGGGGCCCGGG + Intronic
1149772438 17:59332085-59332107 GCGTCTCCCGCCCCGGCCGGGGG - Intronic
1149806125 17:59619794-59619816 GCGCCGCGCGCGGCGGGCGCAGG - Intronic
1150239946 17:63622921-63622943 GCGCGCCGCGGCCCGGGCGGGGG + Intronic
1150373509 17:64661885-64661907 GCCCCCGCCGCCCCCGCCGCCGG - Exonic
1150485040 17:65537549-65537571 GCGCCCGGCGAGGCGGCCGCGGG + Exonic
1150488526 17:65560094-65560116 GCGCCCCGAGCCCGGGCGGGGGG + Intronic
1151707759 17:75779586-75779608 GCGCCGCGCGCCGCGGCCGTTGG - Intronic
1151761239 17:76104289-76104311 GCGCCCCCCACCCCGTCCCCTGG - Intronic
1152197192 17:78924870-78924892 ACGCCCCGCCCGCCCGCCGCTGG - Intronic
1152352243 17:79790399-79790421 GTGCCATGCGCCCGGGCCGCTGG - Intergenic
1152362431 17:79838963-79838985 GAGCCCCGCGCCTCGGCCCCCGG + Intronic
1152618016 17:81346559-81346581 GCTCCCCGCACCCCCGACGCGGG - Intergenic
1152689742 17:81712526-81712548 CCGCCCCGCGTCCCGGGCCCCGG - Intronic
1153219137 18:2847093-2847115 GCGGGCGGCGCCCTGGCCGCCGG + Exonic
1153457231 18:5295278-5295300 CCGCCCCCGCCCCCGGCCGCGGG - Intronic
1153515163 18:5895440-5895462 CCGCCCCGAGCCGCCGCCGCGGG - Exonic
1153805717 18:8706714-8706736 GTGAGCCGCGCCTCGGCCGCAGG + Intronic
1153851903 18:9102759-9102781 GCGCTCCGGGCCCGGGCGGCTGG + Exonic
1155199345 18:23503583-23503605 GCCCCCGGGGCCCCCGCCGCGGG + Exonic
1155507829 18:26549170-26549192 GCCCGCTGCGCCCTGGCCGCGGG - Exonic
1156008601 18:32471031-32471053 GCGCGCCGAGCCGCGGGCGCTGG - Intergenic
1156350446 18:36297676-36297698 GCAGCCCGGGCTCCGGCCGCGGG - Intergenic
1156350484 18:36297805-36297827 GGGGCCCGCGCCCCCGCGGCAGG + Intronic
1157492995 18:48136928-48136950 CCTCCCCACGGCCCGGCCGCTGG + Intronic
1157529531 18:48409493-48409515 GCGCCCCGCGCCCGCGCCGCCGG + Intronic
1157753086 18:50195204-50195226 GCGCCCCGCCCCCGGCCCGGAGG - Intergenic
1160204634 18:76822694-76822716 GCGGGCCCCGCACCGGCCGCCGG - Intronic
1160453343 18:78979745-78979767 GCCCCCCCCGCCGCCGCCGCCGG - Intergenic
1160499590 18:79395502-79395524 GCGCCCCCCTGCCCGGCCCCCGG + Intergenic
1160659316 19:291009-291031 GCATCCCCCGCCCCGGCAGCAGG - Exonic
1160703693 19:519466-519488 GCTCCGCGCGCCCCGCACGCGGG - Exonic
1160715067 19:572785-572807 CCGCCCCGCGCCGAGGCCCCAGG - Intronic
1160763762 19:798111-798133 GCGCCCCGGGCCGCGGCCAAGGG + Intronic
1160775523 19:853407-853429 GCGCCCCCCGCCCCGCCCGGCGG - Intronic
1160809013 19:1005018-1005040 GCGCCCTGCGGGACGGCCGCTGG + Exonic
1160814439 19:1028684-1028706 CCCCCCCGCTGCCCGGCCGCCGG - Intronic
1160893033 19:1389420-1389442 CCGCCCTGCTCCACGGCCGCAGG - Intronic
1160947874 19:1652014-1652036 GCCCCCCGCGCCCCCGCCCGGGG + Intronic
1160966762 19:1750056-1750078 GCGCCCCAAATCCCGGCCGCCGG - Intergenic
1161029349 19:2050727-2050749 GGGCCCCGCGCCCCCCACGCCGG + Intronic
1161031860 19:2061342-2061364 GCGCCCAGAGCCCCGGCCGCCGG - Intergenic
1161162912 19:2770566-2770588 GCCGCCCCCGCCCCCGCCGCTGG + Intronic
1161231955 19:3178891-3178913 GCCCCCCGCGCCCGGCCAGCCGG - Exonic
1161233231 19:3186003-3186025 GCCCCGCGCGGCCCCGCCGCCGG + Exonic
1161313247 19:3606570-3606592 GCGCCCGGACCCCCGGGCGCGGG - Exonic
1161396629 19:4047983-4048005 GGGCGCCCCGCCCCGGACGCGGG + Exonic
1161396680 19:4048244-4048266 CCGCCCCGTGCCCCGTCCACAGG - Exonic
1161425008 19:4198466-4198488 GCCCCCCGCGCCCCGCGCCCCGG + Intronic
1161535593 19:4817063-4817085 GCTCCCCGCGCCCCGGCACCTGG + Exonic
1162100400 19:8335359-8335381 GCGCGCCCAGCCCCGGCCGCGGG - Exonic
1162128235 19:8510865-8510887 GGGCGCGGCGGCCCGGCCGCGGG + Exonic
1163159745 19:15457527-15457549 GCCCCACGCGCGCCTGCCGCCGG - Exonic
1163585499 19:18161401-18161423 GCGCCCAGGGCCCGGACCGCGGG - Exonic
1164594944 19:29526443-29526465 GCGCCCCCTCCCCTGGCCGCCGG - Intergenic
1164615651 19:29665523-29665545 GCGACCCGCAGCCCGGCCGGGGG - Intronic
1164834755 19:31349894-31349916 GGGCGCCGCGCCCCCGCCCCCGG + Intergenic
1164834757 19:31349901-31349923 GCGCCCCCGCCCCCGGCCCCAGG + Intergenic
1165157279 19:33796262-33796284 GCCCCCCGCCCCCCGCCGGCCGG - Intronic
1165311328 19:35030780-35030802 GCGCCCCCCTCCCGGGCCGCCGG - Intronic
1165349387 19:35268093-35268115 CCGGCCCGCGCCCGCGCCGCCGG + Intergenic
1165448586 19:35869719-35869741 GGGACCTGCGCACCGGCCGCTGG + Exonic
1165775730 19:38403351-38403373 GCGCCCCGCGACGCCGCCCCCGG - Exonic
1165922346 19:39307240-39307262 GGGCCCCTCGCCCCGGCCCCGGG + Exonic
1166367307 19:42284206-42284228 GCCCCGCGCGTCCCGGCTGCCGG - Intronic
1167074985 19:47243220-47243242 TCGGCCCGCGCCGCAGCCGCGGG + Intergenic
1167975775 19:53224847-53224869 GCGCTCCGGGCCCGGGCCGCTGG - Intergenic
1168257589 19:55175133-55175155 GCGCCCCGAGCCACGCCCCCAGG - Intronic
1168301539 19:55407644-55407666 GGGCCCCCCGCCCCGGCCGGCGG - Exonic
1168305574 19:55433392-55433414 GCCCCCCGGGCCCCAGCAGCAGG + Exonic
925419957 2:3703725-3703747 GCGCCCCGCTCCTCGCTCGCCGG - Exonic
925609383 2:5691535-5691557 GCGCGCCCCGCCCCGGGCGGGGG - Intergenic
926130825 2:10302512-10302534 GCCCCCCGCCCCCACGCCGCAGG - Intergenic
926268252 2:11344923-11344945 GCGCCCCCTGCCCCTCCCGCCGG + Intronic
926914338 2:17878500-17878522 GCGCCCCGGGCCGAGGGCGCGGG - Intronic
927215858 2:20667456-20667478 GCGCGCCGCGCCGCGGGCTCCGG + Exonic
927472662 2:23386764-23386786 CAGCCCCGCGCTCCGGCCCCAGG - Intronic
927751462 2:25673726-25673748 GCGCCCCGCCCACCGGTCGCCGG + Intergenic
927881432 2:26692635-26692657 GCCCCCCGCCCCCCGCCCGCAGG - Intergenic
928998729 2:37324818-37324840 GCCCCCCGCCCTCCGGCCCCAGG - Intergenic
930762322 2:55050077-55050099 GTGCCCACCGCCCCTGCCGCCGG - Exonic
931614587 2:64143830-64143852 GCGCCCCGCTCCCGGGCGGAGGG + Intronic
932608086 2:73177497-73177519 GCGCCCCACCTCCCGGCAGCGGG - Intergenic
932625559 2:73293338-73293360 GCGCCCGGGGCCTCGCCCGCTGG + Exonic
932692726 2:73926996-73927018 GCGCCCCGCGTGCAGGCCTCTGG - Exonic
932700018 2:73985511-73985533 GCGCCCGCCGCGCCCGCCGCCGG - Intergenic
934670397 2:96208735-96208757 GCGCCCTGCATCCCGGCCCCGGG - Exonic
935622856 2:105144184-105144206 ACCCCCCGCGGCCCGGCCACCGG - Intergenic
936433292 2:112482316-112482338 GCGCCGCGCGCCCGGGCCGCCGG - Exonic
936556960 2:113504072-113504094 GCGACCCTCGGCCCAGCCGCCGG - Intergenic
937917460 2:127106158-127106180 GCCACCCGCTCCCCGGCCGCCGG + Intronic
938407360 2:131039940-131039962 GCGCCCTGCGCCGCAGCGGCGGG - Intronic
938416143 2:131105260-131105282 GCGCGGCGGGCCCCGGCCGGTGG - Exonic
938727296 2:134120154-134120176 GCGCCCGGGGCCGCCGCCGCGGG - Intronic
941476127 2:165953712-165953734 GAGCCCCGCGGCCCGGCCTCGGG - Exonic
941476148 2:165953805-165953827 GCGCCCCGGGCCCCAGCGGGAGG + Exonic
941808589 2:169734066-169734088 GCGTCCCGAGCCCCGGCGGGAGG + Exonic
942565906 2:177264624-177264646 CCGCGCCGCGCCTCGGCAGCCGG - Exonic
945245253 2:207711709-207711731 CCGCCCCGCGGCCCGGCCCCGGG - Intronic
946921525 2:224585497-224585519 GCGTCCCCCGCGGCGGCCGCCGG - Intergenic
947797224 2:232902048-232902070 GCGCCCTGCGCCCCTGGCTCTGG - Intronic
947860647 2:233354916-233354938 GCGCCCCGGGCGCCGCGCGCTGG + Intronic
948384346 2:237572237-237572259 GCGCCCTGTGCCCCCGCAGCGGG - Intergenic
948438055 2:237967194-237967216 GCGCCCTCCGCCCGGCCCGCAGG - Intronic
948802227 2:240438141-240438163 GCACCCCGAGCCCTGGCAGCAGG - Intronic
949018211 2:241725427-241725449 GCTCCGCGTGCCCCGCCCGCTGG + Exonic
1168795899 20:610070-610092 GCGGCCCGGGCCCCGGGGGCGGG - Exonic
1169065677 20:2693156-2693178 GCGCCCCGCGCTGGCGCCGCGGG + Intronic
1169214716 20:3786490-3786512 GCGCCCCCCGCCCCGGGGCCCGG + Exonic
1169483512 20:6006481-6006503 GCGGCGCCCGCTCCGGCCGCTGG - Exonic
1170674530 20:18467043-18467065 GCGAGCCGCGCCCCGCCCACTGG + Exonic
1170890061 20:20368802-20368824 GCGGCCCGCGGCCCGGGCCCCGG + Exonic
1171346373 20:24469396-24469418 GCGCCCCTCGCCCAGCCTGCCGG + Exonic
1172118317 20:32584183-32584205 GCGCCTCGCGCTCCCGCCCCCGG - Intronic
1172143917 20:32743280-32743302 GCGCCCCACGCCCCGCCGCCGGG + Intronic
1172684812 20:36745815-36745837 GCTCCCCGCGCCCAGCCCGCCGG - Intronic
1172962076 20:38806445-38806467 GGGCCCCGTGCGCCGGCGGCTGG + Intronic
1174494627 20:50930972-50930994 CCGGCTCGCGCCGCGGCCGCGGG + Exonic
1174611427 20:51801458-51801480 GCGCCCGCCACCCCGGCCACTGG + Intronic
1175215902 20:57391597-57391619 GCGCCGTGCGCCCCGAGCGCGGG + Exonic
1175429218 20:58890705-58890727 GCTCCTCGCGCCCCCGGCGCCGG - Intronic
1175439648 20:58981551-58981573 GGGTCCCGCGGCGCGGCCGCCGG + Intronic
1175811959 20:61863278-61863300 GCATCCCCCGCCCCGGCTGCAGG - Intronic
1175847036 20:62064852-62064874 CCCGCCCCCGCCCCGGCCGCCGG - Exonic
1175847493 20:62066162-62066184 GCATCCCGCGCCCCGCCCGGCGG - Intergenic
1175902956 20:62367173-62367195 GGGCCCCGCGCCGCTGCTGCTGG - Exonic
1175947323 20:62565008-62565030 GCGCCGTGCGGCCCGGCCGCAGG + Exonic
1176058085 20:63159501-63159523 GAGCCACCCGCCCCGGCCCCCGG - Intergenic
1176221155 20:63969853-63969875 GCGCCCCGCGCCCCCCGCCCCGG - Intronic
1176231232 20:64034100-64034122 GCGCCCTCCTCCCCGCCCGCTGG - Intronic
1176380686 21:6111014-6111036 GCGGCCCCCGCCCGGGCGGCGGG + Intergenic
1176548623 21:8212312-8212334 GCGCCCCGCGCCGTGGGGGCGGG + Intergenic
1176556517 21:8256520-8256542 GCGCCCCGCGCCGTGGGGGCGGG + Intergenic
1176567554 21:8395347-8395369 GCGCCCCGCGCCGTGGGGGCGGG + Intergenic
1176575456 21:8439562-8439584 GCGCCCCGCGCCGTGGGGGCGGG + Intergenic
1178610313 21:34073811-34073833 CCCCCGCGCGCCCTGGCCGCGGG + Intronic
1178610388 21:34074003-34074025 CCGCCCCGCCCCCCGCCCGGCGG - Intronic
1178680521 21:34669593-34669615 GTGCCCCGCGCCTCGGCCTCCGG - Exonic
1179150737 21:38806179-38806201 GCGACCCCCGCCCAGGCCCCGGG - Intronic
1179243833 21:39613074-39613096 GCGCCCCGCGCCCCAGCCCCGGG - Intronic
1179742786 21:43427226-43427248 GCGGCCCCCGCCCGGGCGGCGGG - Intergenic
1180068222 21:45423487-45423509 GCCCCCCGCCCCCCGCCCCCCGG + Intronic
1180733796 22:18001149-18001171 GCGCCCCGCCGGCCGGACGCAGG + Intronic
1181567949 22:23751139-23751161 GAGCCCCGCCCCCGGCCCGCGGG + Intergenic
1182222972 22:28773090-28773112 GCGCCCCTCGCGGCGGGCGCGGG + Intronic
1182237088 22:28884125-28884147 GCGCCCGCCGACCCCGCCGCGGG + Intronic
1182295294 22:29308625-29308647 GCCCCCAACGCCCCTGCCGCTGG + Exonic
1182445460 22:30387150-30387172 CCCCGCCCCGCCCCGGCCGCCGG + Exonic
1182697186 22:32205501-32205523 CACCCCCGCCCCCCGGCCGCGGG - Intergenic
1183326732 22:37198675-37198697 GCTCCCCGCTCCCCGGTCCCCGG + Intronic
1183535708 22:38399175-38399197 GCCCCCCCCGCCCCCCCCGCCGG - Intergenic
1183546046 22:38455325-38455347 GCGCCCCCCACCCCCGCTGCAGG + Intergenic
1184101429 22:42343532-42343554 GCGCCCCGCGCTCCGGAGCCCGG - Intronic
1184155075 22:42662172-42662194 GCTCCCGGCGCCCGGGGCGCGGG + Intergenic
1184155077 22:42662176-42662198 TGGACCCGCGCCCCGGGCGCCGG - Intergenic
1184431074 22:44441822-44441844 GCGGCCCCCGCCCTGGCCCCAGG - Intergenic
1184697949 22:46150356-46150378 GGGCCCCGGGCCTCGGCCCCGGG - Intergenic
1185314003 22:50170963-50170985 GCGCCCCGCGCCCCGGCCGCCGG - Intronic
1185409666 22:50674952-50674974 GAGCCCCGGGCCCCCGCCGAAGG - Intergenic
1203253506 22_KI270733v1_random:128617-128639 GCGCCCCGCGCCGTGGGGGCGGG + Intergenic
1203261561 22_KI270733v1_random:173695-173717 GCGCCCCGCGCCGTGGGGGCGGG + Intergenic
950164201 3:10781140-10781162 GCACCCCGCCCCCCGCCCTCTGG - Intergenic
950940245 3:16884599-16884621 GCGCCCCGAGCCCCTGACGTGGG + Intronic
951611277 3:24494901-24494923 GCTCCCCGGGACCCCGCCGCCGG - Intronic
951640354 3:24829279-24829301 GCGCCCCGCCCCCTGGCGCCAGG - Intergenic
952076377 3:29701956-29701978 GGATCCCGCGCCACGGCCGCGGG - Intronic
952816557 3:37452311-37452333 GCGCCGAGCGCGCGGGCCGCGGG - Exonic
953183227 3:40615698-40615720 GCGCCCCGCGCGCCTGCTGCAGG + Intergenic
953484929 3:43286438-43286460 GCAGCCCGCGCGCCGGCCGCAGG + Intergenic
953492739 3:43364437-43364459 GCCCCCCGCCCCCCGCCCGACGG - Intronic
954151821 3:48661746-48661768 GCGCCCCGGGCCGCGTCCCCCGG - Exonic
954378269 3:50205994-50206016 TCGCACGGCGCCCCGGCCTCAGG - Intronic
954613049 3:51956270-51956292 GGGACCCGCGCGCCGGCCGTGGG - Exonic
955239321 3:57165319-57165341 GCGCCCCGGCCGCCCGCCGCTGG + Exonic
956681465 3:71785322-71785344 GCCCCCCGCGCCCCCGCCTCGGG + Intergenic
961081667 3:124033436-124033458 GCAGCCCGCACCCCGGCCCCGGG + Intergenic
961182384 3:124887050-124887072 CCGGCCCCAGCCCCGGCCGCCGG - Exonic
961450289 3:126999509-126999531 CCGGCACGCGCCCCAGCCGCCGG - Intronic
963038435 3:141051596-141051618 ACGGGCCGCGCCTCGGCCGCTGG - Exonic
963827648 3:149971435-149971457 GCACATCGCGGCCCGGCCGCGGG - Intronic
966182032 3:177197062-177197084 GCGCCCCCCGCCCAGGCCCCCGG + Intronic
966595711 3:181723290-181723312 GATCCCCGCGGCCCTGCCGCTGG + Intergenic
966886385 3:184379998-184380020 GCGCCCGACGCCCCGGCCGGGGG - Intronic
967316195 3:188154042-188154064 GCGCCCCACGCCCCGCGCCCCGG - Intronic
967904279 3:194487513-194487535 GGACTCTGCGCCCCGGCCGCAGG + Intronic
968055164 3:195686041-195686063 GTGCCACGCTCCCCGGCCACTGG - Intergenic
968100735 3:195963176-195963198 GTGCCACGCTCCCCGGCCACTGG + Intergenic
968434092 4:576141-576163 GCGCCGCGCGGCCGGACCGCCGG + Intergenic
968479235 4:826336-826358 CCGCCCCCCGCCCCCGCCCCCGG - Intergenic
968479289 4:826421-826443 CCGCCCCCCGCCCCCGCCCCCGG - Intergenic
968653883 4:1770465-1770487 GGACCCCGTGCCCGGGCCGCAGG - Intergenic
968835794 4:2963579-2963601 GCGCCCCTCGCCGCCGCGGCCGG - Intergenic
969368659 4:6716422-6716444 GCGCCCCGGCCCCGGGCAGCAGG - Exonic
969368661 4:6716429-6716451 TCGGGCCGCGCCCCGGCCCCGGG - Exonic
969787953 4:9473770-9473792 GCGCCCCGCGCCCCTGCCATGGG - Intergenic
969788040 4:9474024-9474046 GCGCCCCGCCCCCCTGCCATGGG - Intergenic
969788327 4:9474870-9474892 GCGCCCCGCCCCCCTGCCATGGG - Intergenic
972670999 4:41214148-41214170 GCGCCCTGCGCCCGCGCCGCAGG - Intronic
975689403 4:76949584-76949606 GCTCCACTGGCCCCGGCCGCGGG - Intergenic
975689694 4:76950742-76950764 GCGCCCCGGGGCCGGGCCGGAGG + Intronic
976704615 4:88007784-88007806 GCCGCCCGCGCCCCGCGCGCCGG + Exonic
976704620 4:88007791-88007813 GCGCCCCGCGCGCCGGACCCGGG + Exonic
978532546 4:109729835-109729857 GCGCCCCGCGCCGCGGCTCGGGG - Exonic
978903416 4:113979576-113979598 GCTCCGCGCGGACCGGCCGCGGG - Exonic
979455637 4:120922834-120922856 GCCCCCCGCGCCCCCGCAGCAGG - Exonic
981128404 4:141132624-141132646 CCGCCCGCCGCCCCGGCCCCGGG + Exonic
983296339 4:165873533-165873555 GCTCGCCGAGCCGCGGCCGCGGG + Exonic
984714982 4:182917222-182917244 GCGCCCCGCGCCACGCGCTCGGG + Intronic
984811151 4:183797532-183797554 GCGCCGGGCGCCCGGGCTGCAGG + Intergenic
985580486 5:693233-693255 GCCCCCCGCGCCGCGCCCGCGGG + Intronic
985595144 5:784623-784645 GCCCCCCGCGCCGCGCCCGCAGG + Intergenic
985630010 5:1009228-1009250 CCGCCCCCCGCCCCGCCCGTCGG - Intronic
986721608 5:10564425-10564447 CCTGCCCGCGCCCCGGCCCCCGG + Intronic
986721619 5:10564444-10564466 CCGGCCCGCGCCCCGGCCGCCGG + Intronic
987193242 5:15500354-15500376 GCTCACCGCGCCGCCGCCGCCGG - Exonic
987374030 5:17217877-17217899 GCGCCCCGCCCCGCAGCCCCCGG + Intronic
987696653 5:21341711-21341733 GCCCCCCGCCCCCCAACCGCGGG + Intergenic
988755553 5:34244859-34244881 GCCCCCCGCCCCCCAACCGCGGG - Intergenic
990210723 5:53479978-53480000 GGGTCCCGCGCCCAGGCTGCGGG + Intergenic
990545532 5:56816657-56816679 GCGCCCCCAGCGCCGGCCGCAGG + Intronic
991743786 5:69710587-69710609 GCCCCCCGCCCCCCAACCGCAGG - Intergenic
991753922 5:69844648-69844670 GCCCCCCGCCCCCCAACCGCAGG + Intergenic
991795358 5:70290319-70290341 GCCCCCCGCCCCCCAACCGCAGG - Intergenic
991803547 5:70401403-70401425 GCCCCCCGCCCCCCAACCGCAGG + Intergenic
991823158 5:70585862-70585884 GCCCCCCGCCCCCCAACCGCAGG - Intergenic
991833239 5:70719768-70719790 GCCCCCCGCCCCCCAACCGCAGG + Intergenic
991887725 5:71289838-71289860 GCCCCCCGCCCCCCAACCGCAGG - Intergenic
992663542 5:78984703-78984725 CGGACCCGCGCCCCGGCCGCCGG - Intronic
992813084 5:80408421-80408443 GTTCCCCGCTCCCGGGCCGCCGG + Intronic
995462578 5:112419329-112419351 GGGCCCCGCGCCCCCGCCTTCGG - Intergenic
997470557 5:134114869-134114891 GCGCCCAGCGCCCCGCGCCCCGG + Exonic
997470562 5:134114876-134114898 GCGCCCCGCGCCCCGGCGGGCGG + Exonic
997564209 5:134874671-134874693 TCTCCCCGCGCACCGCCCGCTGG + Intronic
997583941 5:135033907-135033929 GCGCGCCCAGCCCCGGCCCCTGG - Exonic
998018854 5:138753394-138753416 CCGCCCCACGCCCCCGCCCCCGG - Intronic
998156184 5:139788400-139788422 GCGCCGCGCGCCCCGCTCCCTGG + Intergenic
998424211 5:142013074-142013096 GCGCCGCGTGCGCCGCCCGCCGG + Intergenic
998583615 5:143404195-143404217 GTGGCCCGCGCCGCCGCCGCCGG + Intronic
999279842 5:150357913-150357935 GCGGCCCGCGCCCCGTCCCCAGG + Intronic
999768180 5:154756074-154756096 GCGCCCCGCGCCCGCGGCTCCGG - Intronic
1000071398 5:157743944-157743966 GCGCCCGCCGCCCCGGACTCCGG - Exonic
1000330167 5:160199556-160199578 GAGCCCCGCCCGCCGGCCCCAGG - Intronic
1001191640 5:169637497-169637519 CCGCCCCGAGGCCCCGCCGCAGG - Intronic
1001381360 5:171308655-171308677 GCTCCCCTCGCCCCGCGCGCAGG + Exonic
1002046244 5:176543217-176543239 GCGCCGAGCGCCCCGGGCGCAGG - Intronic
1002190068 5:177473347-177473369 CCGCCCCGCCGCCCCGCCGCCGG - Intronic
1002190094 5:177473411-177473433 GAGCCCCCCGCCCCCGCCCCCGG - Intronic
1002190164 5:177473668-177473690 GCCCCCCGCCCCCCGCCGGCCGG - Intronic
1002350059 5:178577185-178577207 GCGCGCCGCGCCCCGGGCTCCGG - Intronic
1002415914 5:179121034-179121056 GCGCACAGCTCCCCCGCCGCAGG - Intronic
1002888968 6:1317394-1317416 GCGCCCCCCGCGTCGGCCGAGGG - Intergenic
1003049335 6:2765770-2765792 GCGCGGTGCGACCCGGCCGCGGG - Exonic
1003593782 6:7456737-7456759 GCATCCCGCACCCGGGCCGCAGG - Intergenic
1003624151 6:7727264-7727286 GCCCCCGGCGCTCCGGCAGCAGG + Exonic
1003645422 6:7910273-7910295 GCCCCCCGCTCCCCGCCAGCCGG + Intronic
1003871173 6:10404463-10404485 CCGCCCCGCCCCGCGGCCGGGGG - Intronic
1004193988 6:13487738-13487760 GCGCGCTGCGCCCGGGCCCCGGG + Intergenic
1005554188 6:26956632-26956654 GCCCCCCGCCCCCCAGCCGCGGG - Intergenic
1007431516 6:41779904-41779926 CCGCCCCGCCCCGCGGCCGCGGG + Intronic
1010703296 6:79077755-79077777 GAGCCCCGCGCCCCGGGCCGCGG + Intronic
1011044403 6:83065926-83065948 GCGCGCCCCGCCCCGGCCTCCGG - Intergenic
1011734419 6:90296975-90296997 GCGTACCGCGCCCCAGCGGCCGG - Intergenic
1011734439 6:90297034-90297056 CCGCCCCCCGCCCCAGCCCCCGG - Intergenic
1013538734 6:111087450-111087472 GCACCCCCCGCCCCGCCGGCTGG - Intergenic
1013619281 6:111872872-111872894 GCGCACGCCGCCCCCGCCGCAGG - Intronic
1017282127 6:152636842-152636864 GGGCGCCGGGCCGCGGCCGCCGG - Intronic
1017811989 6:157990176-157990198 GTGCCCCAGGCCCAGGCCGCAGG + Intronic
1017954952 6:159169708-159169730 ACGCGCCGCGCCCGGGCCCCCGG + Intronic
1018020898 6:159761835-159761857 CCGCCCCGCGCCCCGCGCCCCGG + Exonic
1019344410 7:522343-522365 GCGACCCGGGCCCCGCCGGCGGG + Intergenic
1019689573 7:2403310-2403332 CCGCCGCGCGCCCGGTCCGCCGG + Intergenic
1019735439 7:2647899-2647921 GCGCCCCACTCCCAGGCCCCGGG + Intronic
1019786385 7:2980130-2980152 GAGCCCCACTCCCCGGCCCCTGG + Intronic
1020073652 7:5243460-5243482 GGGCCCCGCGTCCTGGCCGCTGG + Intergenic
1020105793 7:5421718-5421740 GCGCAGCGCGCCACCGCCGCCGG - Intronic
1020106471 7:5424375-5424397 GCACTCCGGGCCCCGGCCCCCGG + Intronic
1020125448 7:5530474-5530496 GCGGCTCACGGCCCGGCCGCAGG - Intronic
1020274326 7:6615595-6615617 GGCCCCCGCGCCCCCGCCCCCGG + Exonic
1021510448 7:21427859-21427881 GGCCCCAGCGCCCCGGCCCCCGG + Intergenic
1021958729 7:25852359-25852381 GCGCCGCGCCCCCCGGACTCTGG + Intergenic
1021992595 7:26152436-26152458 GGTCCCGGCGCCCCAGCCGCCGG - Exonic
1021998332 7:26201613-26201635 GGGCCGCGCGCCGCGCCCGCTGG - Intronic
1022090754 7:27106656-27106678 GTGCCCCGCGGCCCAGCCGGGGG - Exonic
1022207710 7:28180106-28180128 CCGCCCCGCGCCCCGCGCGCCGG + Intronic
1022207714 7:28180113-28180135 GCGCCCCGCGCGCCGGCACTCGG + Intronic
1022363264 7:29684659-29684681 GCCCCCGGCGCCCCGGCCGAAGG + Intergenic
1022428061 7:30285918-30285940 GCCCCCGGCGCCCCGGCAGAAGG - Intronic
1022528241 7:31052102-31052124 GCGCCCCCGACCCCCGCCGCTGG + Intergenic
1022698120 7:32729101-32729123 GCCCCCGGCGCCCCGGCGGAAGG - Intergenic
1022721253 7:32943197-32943219 GCTCCCCGCCCACCGGCGGCTGG - Intergenic
1022923266 7:35037192-35037214 GAGCCCGGCGCGCCGCCCGCCGG - Intronic
1023945110 7:44796864-44796886 TCGCCCCGCGCCCGGGCCTTTGG - Intronic
1024043801 7:45574415-45574437 CCGCCCCGCGCCCCGCGCCCCGG + Intronic
1025207900 7:57004023-57004045 GCCCCCGGCGCCACGGCCCCCGG - Intergenic
1025698084 7:63790275-63790297 GCGACCCGAGCCCAGGTCGCGGG + Intergenic
1025917054 7:65873745-65873767 GCGGCCTGAGCCCAGGCCGCGGG + Intronic
1026470948 7:70694010-70694032 GCGCGCCGAGCCCGAGCCGCCGG - Intronic
1026853627 7:73739239-73739261 GCGCCGCTCGCCCCCGCCGGCGG - Intergenic
1026968582 7:74454696-74454718 GGACCCCCCGCCCCGGCCCCGGG + Intronic
1027001604 7:74658093-74658115 GCGCCCCCCGCCCCCGCCTCGGG + Intronic
1030227465 7:107169150-107169172 GCGGCCCGCGCCTGGGCTGCCGG + Exonic
1031056483 7:116998026-116998048 GCGCCCCGCTCCACGGCACCTGG - Intronic
1031833920 7:126659032-126659054 CCGCCCCCCGCCCCGCCCCCAGG + Intronic
1031966528 7:128031574-128031596 CCGCCCCGCGTGCCGGCAGCCGG - Intronic
1032194667 7:129781941-129781963 GCGCCCCGCCCCCCGCGCTCCGG + Intergenic
1033299900 7:140176586-140176608 GCGCCCCACTGCCCGGCCGGGGG + Intronic
1034439808 7:151080885-151080907 GAGCCGCGAGCCCCGCCCGCGGG + Intergenic
1035021646 7:155804156-155804178 GCGCCCCGCGCCGGGGCGGGAGG - Intronic
1035553542 8:546348-546370 GCGTCCCGCGCCAGGGCCCCAGG - Intergenic
1035751948 8:2002475-2002497 ACGACCCGCGCGCCGACCGCTGG + Exonic
1036803263 8:11808590-11808612 GCGCCCAGGGGCCCGGGCGCAGG + Intronic
1037390509 8:18387233-18387255 CCGCCCCGCGCTCCTCCCGCTGG + Intergenic
1037450893 8:19014351-19014373 GCGCCCCGCAGCCTGGCCTCGGG + Intronic
1037826778 8:22164791-22164813 CTGCCCCGCGCCCCCGCCTCGGG - Exonic
1038566403 8:28622984-28623006 GCGCCCCACGTCCGGCCCGCGGG - Intronic
1038726076 8:30083302-30083324 GCTGCCCTCGCCCCGCCCGCGGG - Intergenic
1038828589 8:31033273-31033295 GCGGCCCCCGCAGCGGCCGCAGG - Exonic
1039996893 8:42541776-42541798 GCCCGCCCCGCCCCGGACGCGGG + Intronic
1040038877 8:42896876-42896898 CCGCCCCGCGTCCCCGCCCCCGG - Intronic
1040076977 8:43246690-43246712 CCGCCCCGCTCCTCCGCCGCAGG - Intergenic
1041166924 8:55101174-55101196 GCGCCCCGCGCCGCCGCCAGGGG + Intergenic
1042367294 8:67952185-67952207 GAGCCCCGCGCCCCCCGCGCCGG + Exonic
1043147286 8:76674178-76674200 GCGGTCCGCGCCCCGGCTCCGGG + Intergenic
1048553979 8:135457621-135457643 GGCCCCCGCGCTCCGGGCGCGGG - Exonic
1048833402 8:138497164-138497186 GCGCCGCGCGCCCTCGCGGCCGG + Intergenic
1049398984 8:142416386-142416408 GCGCCTCCCGCCCCCGGCGCTGG - Intergenic
1049435665 8:142585129-142585151 GCGCCCAGCGCTCCTGCCCCCGG - Intergenic
1049452468 8:142669671-142669693 GGGCCGCGCGCTCAGGCCGCGGG + Intronic
1049660164 8:143816204-143816226 GCGCCCCGGGCCCCGTCCCGCGG - Intergenic
1049746899 8:144266787-144266809 GCCCCCCGCCCCCGGCCCGCCGG - Exonic
1049896041 9:113229-113251 GCGACCCTCGGCCCAGCCGCCGG + Intergenic
1050873969 9:10612889-10612911 CCCCCACGCGCTCCGGCCGCCGG + Intergenic
1050874023 9:10613108-10613130 CCGCCCCGGCCCCCGCCCGCCGG - Intergenic
1051170094 9:14313258-14313280 GCGCTCCGTGCCCAGGGCGCGGG + Intronic
1051170600 9:14315452-14315474 GCGCCCCGGGCCCCGGGGGGTGG - Intronic
1051774514 9:20620546-20620568 GCCCCCCGCGCCGCGCTCGCCGG - Intronic
1055030673 9:71769101-71769123 GCGCCCCCCGCTGCGGCTGCAGG + Intronic
1055321671 9:75088488-75088510 CCGCCCCGCCCCGCGGCCGCCGG - Intergenic
1056126231 9:83538383-83538405 GCCCGCCGCGCCCCGGCCGCTGG - Exonic
1057294615 9:93827865-93827887 CCAGCCCGCCCCCCGGCCGCCGG - Intergenic
1057623167 9:96654890-96654912 GCGCCGGGCGCCCGAGCCGCCGG - Intronic
1058254861 9:102749218-102749240 GCCCCCCGCCCCCCGCCCCCCGG - Intergenic
1058885886 9:109320830-109320852 CCGCGCCGCGCGCCGGCCGAGGG + Exonic
1059102551 9:111484089-111484111 GAGGCCCGCCCCCGGGCCGCGGG - Exonic
1060087434 9:120714793-120714815 GCGCCCCGCGCGGCAGACGCCGG + Intergenic
1060393572 9:123299962-123299984 GCTCCCCTTGCCCCGGCCACTGG + Intergenic
1060700482 9:125746560-125746582 GCGCCTCCCGCCGCCGCCGCCGG - Intergenic
1060700592 9:125746912-125746934 GCTCCCCGCGGCCCGCCCGCAGG + Intergenic
1060766118 9:126296089-126296111 GTGCCCCCCGCCCCGACCACAGG + Intergenic
1061015956 9:127980869-127980891 GCGCCCTTCGGCCCGGCCGGTGG + Intergenic
1061208611 9:129178126-129178148 GCCCGGCGCGCCCCGGCGGCCGG - Exonic
1061317088 9:129803154-129803176 GCGCCCCGCGGCCAAGCGGCAGG - Exonic
1061348086 9:130042871-130042893 GCGGCCCGCGCCCCCTCCCCAGG + Intronic
1061348090 9:130042878-130042900 GCGCCCCCTCCCCAGGCCGCGGG + Intronic
1061700475 9:132411271-132411293 GCGCCCCGCGTCCCAGGTGCGGG + Intronic
1061959224 9:133979586-133979608 GAGCCCGGAGCCACGGCCGCCGG + Intronic
1062146495 9:134992398-134992420 GAGCCCCCCGCCCCGGCAGAGGG + Intergenic
1062230634 9:135479886-135479908 CCTCCCCGCGCCCCGGCCGAGGG + Exonic
1062584178 9:137241581-137241603 GCCCCGCGCGCCCTGGCCGCCGG - Intronic
1062696287 9:137877873-137877895 GCGCCCCGCGCCCTCCCTGCCGG + Exonic
1203469907 Un_GL000220v1:111764-111786 GCGCCCCGCGCCGTGGGGGCGGG + Intergenic
1203477728 Un_GL000220v1:155736-155758 GCGCCCCGCGCCGTGGGGGCGGG + Intergenic
1185506434 X:634835-634857 GGGCCCCCCGCCCCCGCCCCCGG - Intronic
1186410754 X:9342756-9342778 GCGCCCCGCCCCCACGCCGCCGG + Intergenic
1186496426 X:10015490-10015512 CGCCCCCGCGCCCCGGGCGCCGG + Intergenic
1187172998 X:16869998-16870020 GCGGCGCGCGCCGGGGCCGCGGG - Intronic
1187648354 X:21374289-21374311 GCGCCTCGCGCGCCTGCCGTCGG + Intergenic
1187888119 X:23907905-23907927 GCGCGTCGCGCCCGGGCAGCGGG + Exonic
1187900910 X:24025760-24025782 GCGCCCCGCGTCCCGGCTGCCGG + Intronic
1188483065 X:30653709-30653731 CGGCCCGGTGCCCCGGCCGCTGG + Intronic
1190267315 X:48835269-48835291 GTGGCCCGGGCTCCGGCCGCCGG - Intronic
1190337224 X:49269912-49269934 GCGCCCCCCTCGCCGGCCGCGGG + Exonic
1196707280 X:118727494-118727516 CCGCCCCGCCCACCGGCCTCAGG - Intergenic
1197753420 X:129980435-129980457 CCTCCCCCCGCCCCCGCCGCAGG - Intergenic
1198767146 X:140091500-140091522 GCACGCCCCGCCCCGCCCGCCGG - Intergenic
1199035182 X:143041871-143041893 GCTCCCCGCCCCCCCTCCGCCGG - Intergenic
1199772641 X:150984154-150984176 CCGCCCCGGGCCGCGGGCGCCGG - Intronic
1199832907 X:151562748-151562770 GCTCCCCCTGCCCCGGCCGTCGG - Intergenic
1200235537 X:154466186-154466208 GCTCCACGGGCCCCGGCGGCGGG - Exonic
1200292573 X:154886665-154886687 GCGCGTCGCGCTCCTGCCGCAGG - Exonic
1200339417 X:155382405-155382427 GCGCGTCGCGCTCCTGCCGCAGG - Exonic
1200347053 X:155458288-155458310 GCGCGTCGCGCTCCTGCCGCAGG + Exonic