ID: 1185314031

View in Genome Browser
Species Human (GRCh38)
Location 22:50171062-50171084
Sequence CCGCGGACGCAGCCAGGCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185314031_1185314045 26 Left 1185314031 22:50171062-50171084 CCGTGGCCTGGCTGCGTCCGCGG 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1185314045 22:50171111-50171133 CCCATCCTAGCAGGTGTCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 80
1185314031_1185314040 17 Left 1185314031 22:50171062-50171084 CCGTGGCCTGGCTGCGTCCGCGG 0: 1
1: 0
2: 0
3: 13
4: 133
Right 1185314040 22:50171102-50171124 ACAGCCGCCCCCATCCTAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185314031 Original CRISPR CCGCGGACGCAGCCAGGCCA CGG (reversed) Intronic
900108337 1:995659-995681 CCTCGGACGCAGCCGGGGCAAGG - Intergenic
900321557 1:2086874-2086896 CAGCAGACCCAGCCAGGCCAGGG + Intronic
900477643 1:2883446-2883468 CCGCCCAAGCAGCCAGGGCAGGG - Intergenic
901916774 1:12506109-12506131 CAGGGGAGGCAGCCAGGCCCGGG + Intronic
903181282 1:21606167-21606189 CCGGAGCCGCAGCCAGTCCATGG - Exonic
903647905 1:24905748-24905770 CCATGGACAGAGCCAGGCCAGGG - Intronic
904611210 1:31727276-31727298 CCGTGGACTCAGCCAGGCTGGGG - Exonic
904611453 1:31728187-31728209 CCGCTACCGCAGCCAGTCCACGG - Exonic
907306075 1:53513838-53513860 CCCCAGGCGCAGGCAGGCCATGG + Intronic
908401300 1:63774644-63774666 TCGCCGGCGCCGCCAGGCCAGGG + Intronic
920515373 1:206581262-206581284 CAGCGGGAGCAGACAGGCCAGGG + Intronic
1065971943 10:30812565-30812587 CTGGGGAAGCAGCCAGGCCAGGG - Intergenic
1066135976 10:32446483-32446505 CCACGGAGGCAGCCAGGCAGCGG - Exonic
1066440713 10:35436100-35436122 CAGCAGCAGCAGCCAGGCCATGG + Intronic
1067577888 10:47419475-47419497 CCTAGGGCTCAGCCAGGCCAGGG - Intergenic
1067669686 10:48307208-48307230 CCCCGGAGGCAGCCAGGGCGCGG - Intronic
1069844481 10:71361741-71361763 CCGCGCTGGCAGGCAGGCCAGGG + Intronic
1070418661 10:76214379-76214401 CTGCGGACGCAGTCCGGCCTGGG - Intronic
1076730948 10:132438627-132438649 GCAAGGACGCAGCCAGGCCCCGG + Intergenic
1076820103 10:132933970-132933992 CCGCAGACACAGCGAGGTCATGG + Intronic
1077177795 11:1198501-1198523 CCCCGGAGCCAGGCAGGCCAGGG - Intronic
1077530009 11:3090630-3090652 CTCCGGCCACAGCCAGGCCACGG - Exonic
1078638009 11:13069748-13069770 CTGTGGAAGGAGCCAGGCCAAGG - Intergenic
1081576301 11:44320280-44320302 GCGCAGACACAGCCAGGACACGG - Intergenic
1083334622 11:61915399-61915421 CCCTGGAGGCACCCAGGCCAAGG - Intronic
1084403228 11:68956663-68956685 CAGGGGAGGCTGCCAGGCCAGGG + Intergenic
1084523901 11:69684217-69684239 CCGGGGACCCAGCCCTGCCATGG + Intergenic
1094219330 12:27975416-27975438 CCCCGGACAGGGCCAGGCCAGGG - Intergenic
1102644649 12:114396230-114396252 CCGGGGAGGCGGCCGGGCCACGG - Intronic
1104090547 12:125513098-125513120 CTGCGTAGGCAGGCAGGCCAGGG - Intronic
1108487702 13:50943774-50943796 CCAGGGACACAGCCAGGCAAAGG + Intronic
1113434775 13:110282452-110282474 GCGTGGATGCAGCCATGCCAGGG - Intronic
1113873965 13:113583196-113583218 CACCGGACGCAGCCTGGCCCGGG - Intergenic
1115664576 14:35533850-35533872 CCGCGGAGGCAGCCAAGGCGGGG + Intergenic
1117135418 14:52730396-52730418 CCGCCGCCGCAGCCAGCCCGAGG + Exonic
1122317842 14:100836176-100836198 CAGCCGACCCAGCCGGGCCACGG - Intergenic
1122633427 14:103118663-103118685 CCTAGGAGGAAGCCAGGCCAAGG - Intergenic
1122635212 14:103126642-103126664 CCGAGGACGCAGCCGGGTCCAGG + Exonic
1123809792 15:23912376-23912398 GCGCGGGCGCAGACACGCCAAGG + Intergenic
1125503215 15:40252351-40252373 CCGCGGCTGTGGCCAGGCCAGGG + Exonic
1125727364 15:41874876-41874898 CCGGGGAGGCGGCCATGCCATGG + Exonic
1126475221 15:49058792-49058814 CAGTGGAAGCAGCAAGGCCAAGG - Intergenic
1127117506 15:55742890-55742912 CGGCGGTCGCAGCCGGGCGAGGG + Exonic
1128322231 15:66702038-66702060 CCGCGGGCGCTGTCAGGCCCTGG + Intergenic
1129774918 15:78230258-78230280 CGGAGGAAACAGCCAGGCCAGGG - Intronic
1130961038 15:88658828-88658850 CCTTGGACACATCCAGGCCAAGG - Intergenic
1136487498 16:30582819-30582841 CGGCGGCCGCAGTCAGGACAGGG + Exonic
1141035497 16:80622188-80622210 CAGAGCACGCAGCCAGCCCAGGG + Intronic
1141421044 16:83915753-83915775 CCGGGCAGGGAGCCAGGCCAAGG - Exonic
1142185987 16:88694964-88694986 CTGGGGACTCAGCAAGGCCAGGG - Intergenic
1142803519 17:2359701-2359723 CCGCAAAAGCAGCCAGGCCGTGG - Intronic
1142902000 17:3018069-3018091 CCGCGTACGCAGCCACTCCATGG + Exonic
1143140597 17:4739916-4739938 CCGCGGACGCACCGAGCCCGGGG + Intronic
1143183434 17:4997689-4997711 CCGCGGGGGCACCCAGGCCCCGG - Intergenic
1144724521 17:17495151-17495173 CAGCGCCGGCAGCCAGGCCAAGG - Exonic
1150676015 17:67246009-67246031 GCGCGGAGGCAGCCAGGGCTCGG + Intergenic
1151509592 17:74550133-74550155 CCTGGGACCCGGCCAGGCCAGGG - Intergenic
1154502022 18:15001841-15001863 CCGGGGACGCAGCAGTGCCAGGG - Intergenic
1161296815 19:3524311-3524333 TCCCGGATGCAGCCAGGCCGGGG + Intronic
1161977652 19:7615353-7615375 CCGCGGTGGCAGACAGGCCAAGG - Intronic
1162802281 19:13118220-13118242 CTGCCGCCGCAGCCAGGCCAGGG - Intronic
1162924630 19:13924054-13924076 CCGTGGACTCACCCAGGCCCTGG - Intronic
1163663983 19:18594604-18594626 CCAGGGGCGCAGCCGGGCCAGGG - Intronic
1163831248 19:19548148-19548170 CCTCCGACGCTGCCAGGCTAGGG + Intergenic
1163863002 19:19752081-19752103 CCGCGGCCTCAGCCAGGCTTTGG + Intergenic
1165016228 19:32882040-32882062 GAGGGGACGCTGCCAGGCCAGGG + Intronic
1165406138 19:35632541-35632563 CCTCTGACCCAGCCAGGCCCAGG - Intronic
1166094509 19:40530629-40530651 CCGCGGACGCAGACAGGGGAGGG + Intronic
1166132523 19:40754781-40754803 CCAGGGAGGCAGCCAGGACAGGG - Intronic
1168707294 19:58477346-58477368 CAGCTCACGCAGCCGGGCCAGGG - Exonic
929864857 2:45709248-45709270 GGGCAGACCCAGCCAGGCCAAGG + Intronic
932288309 2:70554402-70554424 CTGGGGACGCAGCCAGGAAAGGG + Intergenic
935590514 2:104843124-104843146 CCTCGGACGCAGCCAGCGCGAGG + Intergenic
938198379 2:129352825-129352847 CCCAGGAGGCAGCCAAGCCAAGG + Intergenic
938463293 2:131511469-131511491 CCGCCTCCGCAGCCAGGCCAGGG - Intergenic
946229398 2:218282256-218282278 CCACGGAGGCAGCCTGGACAAGG - Intronic
947795267 2:232890383-232890405 TCAGGGACGCAGCCAGGCCTGGG - Intronic
948348711 2:237320925-237320947 CTGCTGACACTGCCAGGCCAGGG - Intergenic
948794598 2:240395756-240395778 CTGCGGGAGGAGCCAGGCCAGGG + Intergenic
948823288 2:240561047-240561069 CCGCGGCCTCAGCCTGGCGAAGG + Exonic
1169269428 20:4187817-4187839 CTGGGGACACAGCCAGGCCAGGG - Intergenic
1171448110 20:25218762-25218784 CTGGGCACCCAGCCAGGCCAGGG + Intronic
1173284009 20:41654428-41654450 CCCAGGACGCAGCAAGGCCTAGG - Intergenic
1175939308 20:62530639-62530661 CCCCAGACCCAGCCAGGCCACGG - Intergenic
1176181676 20:63752423-63752445 CCGCCAAGGCAGCCAGGCCTCGG - Intronic
1176236408 20:64055790-64055812 CCGCGGCGGGAGCCTGGCCAAGG + Intronic
1176274391 20:64255613-64255635 GGGCGGACGCAGGCAGCCCAGGG + Intergenic
1176367016 21:6039370-6039392 CTCCGGACACAGCCAGGCCTGGG - Intergenic
1179154828 21:38840664-38840686 CCACGGACACAGCCAGCTCAAGG - Intergenic
1179756502 21:43499176-43499198 CTCCGGACACAGCCAGGCCTGGG + Intergenic
1180007555 21:45029961-45029983 CAGCGGAGGCAGGGAGGCCACGG - Intergenic
1180068349 21:45424009-45424031 CTGCAGACGGAGCCGGGCCAGGG + Intronic
1180117360 21:45719099-45719121 CCCCGAATTCAGCCAGGCCAGGG - Intronic
1180972653 22:19823374-19823396 CTGAAGACGCAGCCAGGCCGGGG + Intronic
1181465052 22:23106473-23106495 CCTGGGCCACAGCCAGGCCAGGG - Intronic
1183184281 22:36282813-36282835 CAGCGGGCCCGGCCAGGCCAGGG + Intronic
1184678567 22:46056490-46056512 GCGTGGACGCTGCCCGGCCACGG - Intronic
1185270443 22:49927117-49927139 CCCCGGACGCAGCCATCCAAGGG - Intronic
1185314031 22:50171062-50171084 CCGCGGACGCAGCCAGGCCACGG - Intronic
950570792 3:13798781-13798803 CAGTGGAGGCAGACAGGCCAAGG - Intergenic
954313349 3:49786818-49786840 CCAGGGACGCAGAGAGGCCAAGG - Intergenic
961351646 3:126308062-126308084 CCCCCGTCCCAGCCAGGCCACGG - Intergenic
961446043 3:126982350-126982372 CGGTGGACGCAACCAGGCCAAGG - Intergenic
961817046 3:129556439-129556461 CAGCGGAGTCAGCCGGGCCATGG + Intronic
962313799 3:134345413-134345435 CAGCAGAGTCAGCCAGGCCAGGG - Intergenic
964451399 3:156816633-156816655 GCGCGGGGGCAGCCCGGCCAGGG - Intergenic
966769148 3:183488585-183488607 CCTCGGACTCAGGCAGGACATGG - Exonic
968083646 3:195864043-195864065 CCGGGGATGGAGCAAGGCCAAGG - Exonic
968747966 4:2370718-2370740 CCCCGGACGTGGCAAGGCCATGG + Intronic
968876017 4:3268378-3268400 CCACAGAAGCAGCCAGGCCCAGG - Intronic
968878074 4:3284739-3284761 CAGAGGTAGCAGCCAGGCCACGG + Intergenic
969428326 4:7138698-7138720 CCACTGTGGCAGCCAGGCCAAGG - Intergenic
969480403 4:7443902-7443924 CAGCAGCGGCAGCCAGGCCAGGG - Intronic
973954477 4:56049317-56049339 CCGCGGCCGGAGCCAGACAATGG + Intergenic
985560250 5:582126-582148 CAGCAGATGCAGCCAGGCCCTGG + Intergenic
996308694 5:122078547-122078569 AGGCGAAGGCAGCCAGGCCATGG + Intergenic
998192869 5:140042261-140042283 GCCCGGACGCTGCCAGGCCCGGG + Intronic
1002368323 5:178730242-178730264 GGGCGGACGCAGCCGGGCCCCGG - Intronic
1003995555 6:11537348-11537370 GCGCGCACCCAGCCGGGCCAGGG + Intergenic
1006471988 6:34234928-34234950 CCGCGGAGGCTGCTAGGCCCGGG - Intergenic
1007386423 6:41523294-41523316 CCGTGGCAGCACCCAGGCCATGG + Intergenic
1007584202 6:42978866-42978888 CCGCGCCCGCACCCAGGCCCCGG + Exonic
1011634890 6:89362551-89362573 CCGGAGATGCAGCAAGGCCAGGG + Intergenic
1012384768 6:98667313-98667335 CCGTGCATGCAGCCAGGCGAGGG + Intergenic
1014137781 6:117908046-117908068 CCGCGGGCGCAGAGAGGCCGCGG + Intronic
1018580026 6:165300793-165300815 CCCAGGAAGCAGCCAGGCCTTGG - Intronic
1019314416 7:377799-377821 CTGTGGGCTCAGCCAGGCCAGGG + Intergenic
1019343627 7:519643-519665 CCGCGGGCGCTGCCCGGCCCCGG - Intronic
1019355863 7:578575-578597 CCGCGTCCGCATCCCGGCCATGG - Intronic
1019476504 7:1247164-1247186 CGACGGACGCACCCAGGCCAGGG + Intergenic
1019527981 7:1489387-1489409 CCTCCCACGCAGCCAGGCCTAGG + Exonic
1023844405 7:44112830-44112852 CCGCGGAGGCTGCCAAGCCCAGG + Exonic
1024524355 7:50336152-50336174 CCGGGGACCCAGCCTGGCCACGG - Intronic
1025852166 7:65252348-65252370 CCGCCGCCGCGGCAAGGCCAGGG + Intergenic
1034279929 7:149846204-149846226 CCCTGGACGCTGCCAAGCCATGG - Exonic
1047922747 8:129652164-129652186 CCCCGAAAGCAGCCAGCCCAGGG + Intergenic
1048879751 8:138862470-138862492 CTGAGGACACAGCCAGGCAAAGG - Intronic
1053130058 9:35609560-35609582 CCGAGGCAGCAGCCAGGACAGGG - Exonic
1053289103 9:36868377-36868399 CCTCAGACGCAGCCAGGAGACGG + Intronic
1056746800 9:89310597-89310619 CCCCGGACACAGCCACGCCGCGG + Intergenic
1056905342 9:90642708-90642730 ATGCGGACGCAGCGAAGCCACGG + Intronic
1056943485 9:90974955-90974977 AGGAGGACGCAGACAGGCCATGG + Intergenic
1061275904 9:129569228-129569250 CCGGGGCCGGGGCCAGGCCAGGG + Intergenic
1062139565 9:134948346-134948368 CCGCCGGCACTGCCAGGCCAGGG - Intergenic
1062519047 9:136950086-136950108 CCGCCGGCCCAGCCAGGCAAAGG + Intronic
1195724741 X:107902934-107902956 CCGCCCACCCAGCCAGCCCAGGG + Intronic
1197202992 X:123765057-123765079 CAGCGGACTCAGCCCTGCCAAGG + Intergenic