ID: 1185315055

View in Genome Browser
Species Human (GRCh38)
Location 22:50175345-50175367
Sequence TTGGCCACACATGCCCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 193}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185315047_1185315055 7 Left 1185315047 22:50175315-50175337 CCAGGGTTCTGGGGCCTCTCCCC 0: 1
1: 0
2: 4
3: 38
4: 420
Right 1185315055 22:50175345-50175367 TTGGCCACACATGCCCAGCAAGG 0: 1
1: 0
2: 0
3: 11
4: 193
1185315049_1185315055 -7 Left 1185315049 22:50175329-50175351 CCTCTCCCCACCCATGTTGGCCA 0: 1
1: 0
2: 2
3: 27
4: 352
Right 1185315055 22:50175345-50175367 TTGGCCACACATGCCCAGCAAGG 0: 1
1: 0
2: 0
3: 11
4: 193
1185315042_1185315055 24 Left 1185315042 22:50175298-50175320 CCTACTGGAGTCTGGGTCCAGGG 0: 1
1: 0
2: 0
3: 25
4: 195
Right 1185315055 22:50175345-50175367 TTGGCCACACATGCCCAGCAAGG 0: 1
1: 0
2: 0
3: 11
4: 193
1185315040_1185315055 25 Left 1185315040 22:50175297-50175319 CCCTACTGGAGTCTGGGTCCAGG No data
Right 1185315055 22:50175345-50175367 TTGGCCACACATGCCCAGCAAGG 0: 1
1: 0
2: 0
3: 11
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185315055 Original CRISPR TTGGCCACACATGCCCAGCA AGG Intronic
900296692 1:1955429-1955451 TTGGCCCAGCAGGCCCAGCACGG - Intronic
900315784 1:2055727-2055749 TTGGCCACAGATGCTTATCAAGG + Intronic
901527999 1:9836081-9836103 TTGGCAGCACAGGCCCAGCTTGG + Intergenic
902757954 1:18561848-18561870 ATGCCCTCACATTCCCAGCAAGG - Intergenic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
908175834 1:61554307-61554329 TTGGCCACCCAGTCCCAGGAAGG + Intergenic
912627120 1:111214632-111214654 TTGCCCAGACATGCCCACAACGG - Intronic
916558331 1:165911695-165911717 TACACCACACATGCACAGCATGG - Intergenic
917402477 1:174665653-174665675 CTGGCCAAACATGGCCAACATGG - Intronic
918044730 1:180935117-180935139 ATGGCCACAGAAGCCCAGCCCGG + Exonic
921278447 1:213542334-213542356 TTGGGCATACATGTCCTGCAGGG + Intergenic
1063273834 10:4541714-4541736 CTGGCTACAGATGCCCAGCTGGG - Intergenic
1067840143 10:49669221-49669243 CTGGCCACACATCCCCCGAAAGG + Intergenic
1068369499 10:56095076-56095098 TTGGCAACACCTCTCCAGCAAGG - Intergenic
1070819907 10:79348475-79348497 TCGGCCACACATTGACAGCAGGG + Intronic
1073095177 10:100975122-100975144 AAGGCCACAGATGCCCAGCTGGG + Intronic
1075178713 10:120189800-120189822 TTGGCCACAGCTGCCCAGGGTGG + Intergenic
1075554851 10:123422946-123422968 CTGGCCACCCTTGCCCAGCTGGG - Intergenic
1075656721 10:124166707-124166729 TTGGCTACACAGGCCCACCTTGG + Intergenic
1078274469 11:9829976-9829998 TCTGCCACACAGGCCCACCAGGG + Intronic
1078452782 11:11452834-11452856 TTGGTCAGACATGCCCAGGTAGG - Intronic
1078508467 11:11968584-11968606 TTGACCCCACAGGCTCAGCAGGG + Intronic
1083677297 11:64333209-64333231 TTGTCCACTGCTGCCCAGCATGG - Intergenic
1093490668 12:19700821-19700843 GTGGCCTCAGATGCCCAGCGGGG + Intronic
1093933569 12:24978231-24978253 ATAGCCACACATGGGCAGCACGG + Intergenic
1094366545 12:29688912-29688934 TTGGTCACACAGGGCCACCAGGG - Intronic
1097278723 12:57831071-57831093 TTGGCAAGACATCCCCAGAAAGG + Intronic
1097593748 12:61602686-61602708 TAGGCCCCACATCCCCAACATGG + Intergenic
1097954627 12:65470779-65470801 TTGCCCACACATGGCCAGTGGGG + Intronic
1098110596 12:67117840-67117862 GTGGCAGCAGATGCCCAGCATGG + Intergenic
1098489459 12:71058725-71058747 TAGGCGGCACATGCCCAGCTAGG - Intronic
1104257837 12:127155425-127155447 TTAGCCAGACATGATCAGCAGGG - Intergenic
1104973596 12:132542287-132542309 CAGGCCACACATGCTCAGCCAGG + Intronic
1106657642 13:31763366-31763388 TGAGCCACGCATGCCCAGCCTGG + Intronic
1107215645 13:37915155-37915177 TTGCCCAGACATGCCCACTATGG - Intergenic
1107402330 13:40081761-40081783 TGGGCAACATCTGCCCAGCAGGG + Intergenic
1108529818 13:51318339-51318361 TTTGACACACATGCTCAGAAGGG + Intergenic
1109338932 13:61029268-61029290 TTGACCACTCCTCCCCAGCAGGG - Intergenic
1111521374 13:89409354-89409376 TTGCCAACACGTGCCCAGCTGGG - Intergenic
1111951186 13:94711047-94711069 TTGGCCACTCCTGCCCCGCCTGG + Exonic
1112594939 13:100799212-100799234 TTGACCAGACATGCCCACAATGG - Intergenic
1113367000 13:109685457-109685479 CAAGCCTCACATGCCCAGCAGGG + Intergenic
1119730610 14:76948646-76948668 CTGGCACCCCATGCCCAGCAAGG - Intergenic
1120595527 14:86430568-86430590 TTGGAAACACATACCCAGCAGGG - Intergenic
1121652901 14:95573053-95573075 CTGGCCAACCATGGCCAGCATGG + Intergenic
1124012976 15:25853500-25853522 ATGGCCCCACCTGCCCAGGAAGG - Intronic
1124663525 15:31570746-31570768 CTGGGCACACCTGCCCAGCCTGG - Intronic
1125487423 15:40121921-40121943 CTGGCCACACTTGCCCAACCTGG + Intergenic
1126389923 15:48136780-48136802 TTGGCAAGACAGGCGCAGCAAGG - Exonic
1128308683 15:66616987-66617009 TTGGCCACAGAGCCCCAGAAAGG + Intronic
1129092459 15:73165943-73165965 TTGCCCAGACATGCCCACAATGG - Intronic
1130036440 15:80365635-80365657 TTTGCCACAGCTGCCCAGAAGGG - Intronic
1130242792 15:82212376-82212398 TTGGGAAAACAAGCCCAGCAAGG + Intronic
1130302317 15:82689328-82689350 TTGGCCACCCAGGCCCCGCCCGG + Intronic
1135351348 16:21731813-21731835 ATGGTCACACATGCTCAGCAGGG + Intronic
1135449831 16:22547939-22547961 ATGGTCACACATGCTCAGCAGGG + Intergenic
1135808837 16:25569156-25569178 TTGCCCATACATGCCCACAATGG - Intergenic
1136631264 16:31490455-31490477 TTGACCACACGGGCCCAGCTCGG - Exonic
1137063338 16:35811722-35811744 TTGGCCAAACATGTTCAACAGGG + Intergenic
1139154260 16:64422025-64422047 TTTCCCACACATGCCCACAATGG - Intergenic
1141645891 16:85367384-85367406 TATGCCCCCCATGCCCAGCATGG - Intergenic
1143905492 17:10205801-10205823 TTGCCCAGACATGCCCACAATGG + Intergenic
1144439986 17:15272670-15272692 ATGGGCACAGAAGCCCAGCAAGG + Intergenic
1146284975 17:31568294-31568316 CAGGCCACGCGTGCCCAGCATGG + Intergenic
1146820748 17:35982195-35982217 ATGGCCAACCATGACCAGCAGGG + Intergenic
1150070253 17:62144150-62144172 TTGCCCAGACATGCCCACAATGG + Intergenic
1151261142 17:72916827-72916849 TTGACCAAACATGCCCAGACAGG + Intronic
1152622791 17:81373636-81373658 ATGGGCACACAGGGCCAGCATGG - Intergenic
1152658147 17:81529488-81529510 GTGGCCACACATGTCCCACATGG - Intronic
1152659146 17:81534470-81534492 AGGGGCACCCATGCCCAGCATGG - Intronic
1154325011 18:13383604-13383626 TGCTCCACAGATGCCCAGCATGG + Intronic
1155409997 18:25533391-25533413 TTGCCCAGACATGCCCACAATGG + Intergenic
1155502960 18:26505175-26505197 TTGGCCAGGGATGCCAAGCATGG + Intronic
1155864450 18:30947521-30947543 TTGGTCACACAGGCCCACCCTGG - Intergenic
1156204755 18:34873493-34873515 TTTGCCAGCCATGGCCAGCAAGG + Intronic
1157560281 18:48640630-48640652 TTGGCTGCACATGTCCAGGAAGG + Intronic
1157906195 18:51572281-51572303 TTAGCCAGACATGATCAGCAGGG + Intergenic
1160802878 19:978527-978549 TTGGCCACACAGGGCCAGCCGGG + Intergenic
1160881595 19:1323311-1323333 TGGGCGACACGGGCCCAGCAGGG + Intergenic
1160932289 19:1576485-1576507 TTGCCCACAGATGCCCAGGCCGG + Intronic
1161064127 19:2229247-2229269 TTGGCCACCCGTGCCCTCCAGGG + Intronic
1161716797 19:5880756-5880778 TTGTCCAAACATCCCCAGCCAGG - Intronic
1162262439 19:9543867-9543889 TTAGCCAGACATGATCAGCAGGG - Intergenic
1164638340 19:29807528-29807550 GTGGCCACAGATGTCCAGCTTGG + Intergenic
1165116092 19:33529662-33529684 TTGTGCACACAGGCCCTGCAGGG - Intergenic
1165249440 19:34517458-34517480 TTAGCCAGACATGATCAGCAGGG - Intergenic
1167680671 19:50918242-50918264 TTGACCACACCTGCCCACTATGG - Intergenic
925586969 2:5474591-5474613 TTGCCCCCACAAGCCCAGCTTGG + Intergenic
927945518 2:27132911-27132933 TTGGCTACAGGTGCCCAGCCTGG - Exonic
929574674 2:43044133-43044155 GAGGCCAGACAGGCCCAGCACGG + Intergenic
931076650 2:58722451-58722473 TTGGGCCATCATGCCCAGCATGG + Intergenic
931232640 2:60387565-60387587 AGGGCCCCACATGCCCAGTAGGG + Intergenic
932084332 2:68744889-68744911 GTGGCCTGAAATGCCCAGCATGG + Intronic
932283228 2:70512659-70512681 CTGCCCACATCTGCCCAGCAGGG + Intronic
932582442 2:73000558-73000580 GAGGCCACACATCCCCAGAAAGG + Intronic
937350409 2:121156748-121156770 TGGGCAGCACATGCCAAGCAGGG - Intergenic
937361765 2:121234646-121234668 ATAGCCACACATGGACAGCATGG - Intronic
937885690 2:126898685-126898707 TTGGAGTCACATGCTCAGCAGGG - Intergenic
938390479 2:130901320-130901342 GAGGCCACACCAGCCCAGCAGGG - Intronic
938392078 2:130914666-130914688 TTGGCCACATATCCACAACAGGG + Intronic
939265285 2:139865033-139865055 TTGGCCAGACATGCCCACAATGG + Intergenic
939800060 2:146697355-146697377 TTGCCCAGACATGCCCACAATGG - Intergenic
940183152 2:150956507-150956529 TTAGCCAGACATGATCAGCAGGG - Intergenic
940508586 2:154585480-154585502 TTAGCCAGACATGATCAGCAGGG + Intergenic
943562296 2:189478155-189478177 TTGGCCACGGCTGCCCAGAATGG + Intergenic
945893228 2:215452896-215452918 TGGGCCACTCCTGGCCAGCAGGG - Intergenic
946032141 2:216713812-216713834 TTGTTCACACATGCCGACCAAGG + Intergenic
946160047 2:217830472-217830494 GTGGCCCCACATGGCCACCAAGG + Intronic
946245406 2:218384433-218384455 TTGGAGAAACATGGCCAGCAGGG - Intronic
948433979 2:237940039-237940061 TTGCCCAGACATGCCCACAATGG - Intergenic
948748009 2:240109867-240109889 TTTGTCACATATGCCCAGCCAGG + Intergenic
948773788 2:240269498-240269520 TTGGCCACTCCAGCCCAGCCAGG - Intergenic
1171186350 20:23126729-23126751 TTGGCCACAAATGCCCACAGTGG - Intergenic
1172121668 20:32602413-32602435 TTGGGGACACATGGCCAGAATGG - Intronic
1174267100 20:49339927-49339949 TTGCCCAGCCTTGCCCAGCAGGG + Intergenic
1174659745 20:52201330-52201352 TGGTCCAGACATGCACAGCATGG + Intronic
1175862422 20:62157394-62157416 CTGGCCACACCTGAGCAGCAGGG - Intronic
1176098818 20:63355917-63355939 CTGGCCACTCCTGCCCACCAAGG + Intronic
1177400083 21:20592606-20592628 TTGCCCAGACATGCCCACAATGG - Intergenic
1178901783 21:36604749-36604771 TTGACCACACAGGCCCTGGACGG - Intergenic
1179558909 21:42200219-42200241 CTGGCCGCACATGCTCACCAGGG - Intronic
1181804367 22:25366156-25366178 TGGGCCACACGTGCCCAGGCTGG - Intronic
1184642213 22:45878691-45878713 GTGGCCCCGCCTGCCCAGCAGGG + Intergenic
1184872104 22:47247332-47247354 TTGGCAGCAGATGCCCAGAAAGG + Intergenic
1185148471 22:49151606-49151628 TGGGACACACAGGCCCAGCATGG - Intergenic
1185315055 22:50175345-50175367 TTGGCCACACATGCCCAGCAAGG + Intronic
950509610 3:13418444-13418466 TTGGCCAGACAAGCCAGGCATGG + Intronic
951524435 3:23640172-23640194 TTGGCCACACCTGCCCAGAGTGG + Intergenic
951641435 3:24840423-24840445 TTCCCCAGAAATGCCCAGCAAGG + Intergenic
953537292 3:43786178-43786200 TTGGGGGCCCATGCCCAGCAGGG - Intergenic
955080060 3:55650019-55650041 TTGGAGGCACATGGCCAGCAAGG - Intronic
955599435 3:60629228-60629250 TTGGCCACATCTGCCCAGAGTGG + Intronic
956125247 3:66004856-66004878 TTAGCCACAGAAGCCCACCAAGG + Intronic
959582138 3:107992982-107993004 TTGGCAGCCCATGCCCAGCTGGG - Intergenic
961494362 3:127280447-127280469 TTGCAGACAGATGCCCAGCAAGG + Intergenic
962852491 3:139318459-139318481 TTTCCCACACTAGCCCAGCAGGG - Intronic
963111641 3:141693540-141693562 TTAGCCAGACATGATCAGCAGGG + Intergenic
964165843 3:153704385-153704407 TGGGCCACAGATACACAGCAGGG - Intergenic
965336524 3:167434683-167434705 TTAGCCAGACATGATCAGCAGGG - Intergenic
969892664 4:10274196-10274218 TTGGACAGACAGGCCAAGCATGG - Intergenic
972350368 4:38231057-38231079 TGGGTCACACATGCCCGGCCAGG - Intergenic
972908244 4:43778399-43778421 TTGGTCACACATGCCAACCCTGG - Intergenic
973711368 4:53633154-53633176 ATGGCCACACATCCCTTGCAAGG + Intronic
974488114 4:62529912-62529934 TTGACCACCCATTCCCATCATGG + Intergenic
975210654 4:71696177-71696199 TTGGGCAGACATGCCTAGCCTGG + Intergenic
978138299 4:105289669-105289691 TTGTCCACCCATGCCCATCATGG - Intergenic
986610510 5:9562272-9562294 TTTGCCACTCACCCCCAGCAGGG + Intergenic
987809132 5:22811337-22811359 TAGGCCACAGATGCCCTGTATGG + Intronic
992136955 5:73755684-73755706 TTGAGCAGGCATGCCCAGCATGG - Intronic
995710732 5:115032932-115032954 TTGCCCAGACATGCCCACAATGG + Intergenic
996584200 5:125066594-125066616 TGGGTCACACATGCCCAGGGTGG + Intergenic
997998036 5:138602368-138602390 TTGGCCACAAAGGCCATGCACGG - Intergenic
1001643881 5:173265568-173265590 TTGGCCACACATCCACAGTTCGG - Intergenic
1001775739 5:174327919-174327941 GTGGCCCCACATGCCCAGGGTGG - Intergenic
1002437777 5:179242712-179242734 TTGGCCACACACCCCCAGAGTGG - Intronic
1002779504 6:355405-355427 TTGCCCACACATGCACACCCTGG - Intergenic
1003162892 6:3651177-3651199 TCGGCCCCACTTGCCCAGCAAGG + Intergenic
1004002661 6:11609650-11609672 TTGGCGTCTCTTGCCCAGCAAGG + Intergenic
1004545825 6:16597296-16597318 TGGTCCACATATGCCCAACAGGG - Intronic
1005787279 6:29257385-29257407 TTGGCCACACCTGTCCAGAGTGG + Intergenic
1007487096 6:42188497-42188519 TTGGCCACAAGTGGCCAGCGGGG - Intronic
1011684586 6:89814190-89814212 CTGACCACCCATTCCCAGCATGG - Intronic
1012341251 6:98127104-98127126 TAGGCCACATCTGGCCAGCAGGG + Intergenic
1012914587 6:105155890-105155912 TTGGCCACACATTGCCATCATGG - Intergenic
1013050806 6:106533272-106533294 TTGCCCAAGCATGCCCAGAAGGG - Intronic
1014434772 6:121409088-121409110 TTTGACACACATGGCCAGCTTGG + Intergenic
1014814900 6:125924791-125924813 TTGGCCATACATGCCCAGAGTGG - Intronic
1016306637 6:142691637-142691659 TTGGCCACACATGCGGATAAAGG + Intergenic
1017542365 6:155415928-155415950 GTGGGAACACATGCCAAGCAAGG - Intronic
1017752554 6:157501957-157501979 TTGACCACACATGGCCACCGTGG + Intronic
1019450044 7:1092863-1092885 TTGGCCGCATAGGCCCAGCCAGG + Exonic
1019676954 7:2319467-2319489 TTGGCCAACCATGGCCAACATGG + Intronic
1020280648 7:6648333-6648355 GTGGCCACAGATCCCCACCAAGG - Intronic
1021933933 7:25611141-25611163 CTGGCCACATATGGCCAGTAAGG - Intergenic
1029736545 7:102468673-102468695 TCGGGCACCCTTGCCCAGCAGGG - Intronic
1032580790 7:133101506-133101528 TTGACCAGACCTGCCCTGCATGG - Intergenic
1032608470 7:133384964-133384986 TTGGCCACGCATCTGCAGCATGG + Intronic
1033895040 7:146058422-146058444 ATGGGCAGGCATGCCCAGCATGG + Intergenic
1034698242 7:153074026-153074048 TCACCCACACCTGCCCAGCAAGG - Intergenic
1035554223 8:553487-553509 TTGGACACTCATGCCCTCCATGG - Intergenic
1036472146 8:9061688-9061710 TTAGCCAGACATGATCAGCAGGG + Intronic
1036549893 8:9806570-9806592 TTAGCCAGACATGATCAGCATGG - Intergenic
1038406142 8:27324385-27324407 TAGGGCCCACCTGCCCAGCATGG - Intronic
1039134992 8:34311979-34312001 TTGGCCAACCATGGCCAACATGG - Intergenic
1039884554 8:41647666-41647688 TTGGCCAAAAATTCCAAGCACGG - Intronic
1041651648 8:60308740-60308762 TTAGCCAGACATGATCAGCAGGG + Intergenic
1044768036 8:95597471-95597493 TTGGCCAACCATGGCCAACATGG - Intergenic
1049937863 9:516937-516959 TTGGCCCCAGATGCCCTGCCAGG + Intronic
1050162506 9:2732926-2732948 CTGGCCACATCTGCTCAGCACGG + Intronic
1051197018 9:14573194-14573216 TTGGCTGTACATTCCCAGCAGGG - Intergenic
1053135683 9:35649178-35649200 TTGGCCCCTCATCCCCAGCTAGG + Intergenic
1056222555 9:84464731-84464753 TTGGCCACATATGCAGACCACGG - Intergenic
1057172393 9:92970840-92970862 GTGGCCACACCAGCCCAGGAGGG + Intronic
1059307081 9:113362319-113362341 TTGGCACCAGATACCCAGCAGGG - Intronic
1059402310 9:114078010-114078032 CAGGCCGCACTTGCCCAGCAGGG + Intronic
1185615171 X:1417844-1417866 TTGCACACACATACCCACCATGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1188011570 X:25061910-25061932 TTGGCCACACATGCCGATAGAGG + Intergenic
1188103579 X:26120940-26120962 TTGGAAACACATGCCCAGGTGGG - Intergenic
1188257473 X:27980552-27980574 ATGGCCACACATGGCCAGAGTGG + Exonic
1188346056 X:29066920-29066942 TTGGCCACACCTGTCCAGATTGG + Intronic
1189578796 X:42383960-42383982 TTGGCTACAGATGAACAGCATGG - Intergenic
1189986206 X:46555651-46555673 GTGGGCCCCCATGCCCAGCAAGG + Intergenic
1199821500 X:151453420-151453442 TTGCCCTCCCATGCCCAACAAGG - Intergenic
1200393497 X:155968338-155968360 TTGCCCAGACATGCCCACAATGG - Intergenic