ID: 1185315144

View in Genome Browser
Species Human (GRCh38)
Location 22:50175745-50175767
Sequence GGCAGCCGGGAGCTCCGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185315134_1185315144 28 Left 1185315134 22:50175694-50175716 CCTCCCTGAGCAGGCTGTCTGGA 0: 1
1: 0
2: 3
3: 17
4: 252
Right 1185315144 22:50175745-50175767 GGCAGCCGGGAGCTCCGTGTGGG No data
1185315136_1185315144 24 Left 1185315136 22:50175698-50175720 CCTGAGCAGGCTGTCTGGACTGG 0: 1
1: 0
2: 1
3: 24
4: 208
Right 1185315144 22:50175745-50175767 GGCAGCCGGGAGCTCCGTGTGGG No data
1185315135_1185315144 25 Left 1185315135 22:50175697-50175719 CCCTGAGCAGGCTGTCTGGACTG 0: 1
1: 0
2: 2
3: 25
4: 161
Right 1185315144 22:50175745-50175767 GGCAGCCGGGAGCTCCGTGTGGG No data
1185315132_1185315144 29 Left 1185315132 22:50175693-50175715 CCCTCCCTGAGCAGGCTGTCTGG 0: 1
1: 0
2: 3
3: 32
4: 307
Right 1185315144 22:50175745-50175767 GGCAGCCGGGAGCTCCGTGTGGG No data
1185315140_1185315144 -7 Left 1185315140 22:50175729-50175751 CCTCAGTGGTGATGATGGCAGCC No data
Right 1185315144 22:50175745-50175767 GGCAGCCGGGAGCTCCGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185315144 Original CRISPR GGCAGCCGGGAGCTCCGTGT GGG Intronic
No off target data available for this crispr