ID: 1185315488

View in Genome Browser
Species Human (GRCh38)
Location 22:50177218-50177240
Sequence GATCTTGGGCGCGCGGCCCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 45}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185315488_1185315493 0 Left 1185315488 22:50177218-50177240 CCGAGGGCCGCGCGCCCAAGATC 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1185315493 22:50177241-50177263 GAGAAGCAGATCCAGTCCAAGGG 0: 1
1: 0
2: 2
3: 13
4: 183
1185315488_1185315492 -1 Left 1185315488 22:50177218-50177240 CCGAGGGCCGCGCGCCCAAGATC 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1185315492 22:50177240-50177262 CGAGAAGCAGATCCAGTCCAAGG 0: 1
1: 0
2: 1
3: 10
4: 146
1185315488_1185315497 14 Left 1185315488 22:50177218-50177240 CCGAGGGCCGCGCGCCCAAGATC 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1185315497 22:50177255-50177277 GTCCAAGGGCCCGGGCATCACGG 0: 1
1: 0
2: 0
3: 19
4: 132
1185315488_1185315495 6 Left 1185315488 22:50177218-50177240 CCGAGGGCCGCGCGCCCAAGATC 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1185315495 22:50177247-50177269 CAGATCCAGTCCAAGGGCCCGGG 0: 1
1: 1
2: 1
3: 23
4: 214
1185315488_1185315494 5 Left 1185315488 22:50177218-50177240 CCGAGGGCCGCGCGCCCAAGATC 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1185315494 22:50177246-50177268 GCAGATCCAGTCCAAGGGCCCGG 0: 1
1: 0
2: 1
3: 7
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185315488 Original CRISPR GATCTTGGGCGCGCGGCCCT CGG (reversed) Exonic