ID: 1185315753

View in Genome Browser
Species Human (GRCh38)
Location 22:50178455-50178477
Sequence CCCGTGGGCCGCTGTGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 247}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185315753_1185315765 3 Left 1185315753 22:50178455-50178477 CCACAGCCACAGCGGCCCACGGG 0: 1
1: 0
2: 3
3: 19
4: 247
Right 1185315765 22:50178481-50178503 CTGGCCAGGGCGCTAGGGAAGGG 0: 1
1: 0
2: 3
3: 90
4: 431
1185315753_1185315764 2 Left 1185315753 22:50178455-50178477 CCACAGCCACAGCGGCCCACGGG 0: 1
1: 0
2: 3
3: 19
4: 247
Right 1185315764 22:50178480-50178502 CCTGGCCAGGGCGCTAGGGAAGG 0: 1
1: 0
2: 4
3: 28
4: 329
1185315753_1185315766 6 Left 1185315753 22:50178455-50178477 CCACAGCCACAGCGGCCCACGGG 0: 1
1: 0
2: 3
3: 19
4: 247
Right 1185315766 22:50178484-50178506 GCCAGGGCGCTAGGGAAGGGAGG 0: 1
1: 0
2: 1
3: 30
4: 321
1185315753_1185315768 7 Left 1185315753 22:50178455-50178477 CCACAGCCACAGCGGCCCACGGG 0: 1
1: 0
2: 3
3: 19
4: 247
Right 1185315768 22:50178485-50178507 CCAGGGCGCTAGGGAAGGGAGGG 0: 1
1: 0
2: 3
3: 24
4: 384
1185315753_1185315769 8 Left 1185315753 22:50178455-50178477 CCACAGCCACAGCGGCCCACGGG 0: 1
1: 0
2: 3
3: 19
4: 247
Right 1185315769 22:50178486-50178508 CAGGGCGCTAGGGAAGGGAGGGG 0: 1
1: 0
2: 3
3: 47
4: 514
1185315753_1185315772 21 Left 1185315753 22:50178455-50178477 CCACAGCCACAGCGGCCCACGGG 0: 1
1: 0
2: 3
3: 19
4: 247
Right 1185315772 22:50178499-50178521 AAGGGAGGGGGCCTGGCTTGAGG 0: 1
1: 0
2: 2
3: 62
4: 515
1185315753_1185315771 14 Left 1185315753 22:50178455-50178477 CCACAGCCACAGCGGCCCACGGG 0: 1
1: 0
2: 3
3: 19
4: 247
Right 1185315771 22:50178492-50178514 GCTAGGGAAGGGAGGGGGCCTGG 0: 1
1: 0
2: 9
3: 88
4: 904
1185315753_1185315762 -2 Left 1185315753 22:50178455-50178477 CCACAGCCACAGCGGCCCACGGG 0: 1
1: 0
2: 3
3: 19
4: 247
Right 1185315762 22:50178476-50178498 GGAGCCTGGCCAGGGCGCTAGGG 0: 1
1: 0
2: 0
3: 24
4: 214
1185315753_1185315770 9 Left 1185315753 22:50178455-50178477 CCACAGCCACAGCGGCCCACGGG 0: 1
1: 0
2: 3
3: 19
4: 247
Right 1185315770 22:50178487-50178509 AGGGCGCTAGGGAAGGGAGGGGG 0: 1
1: 1
2: 3
3: 68
4: 881
1185315753_1185315761 -3 Left 1185315753 22:50178455-50178477 CCACAGCCACAGCGGCCCACGGG 0: 1
1: 0
2: 3
3: 19
4: 247
Right 1185315761 22:50178475-50178497 GGGAGCCTGGCCAGGGCGCTAGG 0: 1
1: 0
2: 4
3: 33
4: 428
1185315753_1185315758 -10 Left 1185315753 22:50178455-50178477 CCACAGCCACAGCGGCCCACGGG 0: 1
1: 0
2: 3
3: 19
4: 247
Right 1185315758 22:50178468-50178490 GGCCCACGGGAGCCTGGCCAGGG 0: 1
1: 1
2: 1
3: 53
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185315753 Original CRISPR CCCGTGGGCCGCTGTGGCTG TGG (reversed) Intronic
900392965 1:2441719-2441741 CCCGTGGGCCAGTGTGGCCAAGG + Intronic
901222015 1:7588615-7588637 AACATGGGCCACTGTGGCTGGGG - Intronic
901495666 1:9620089-9620111 CCCATGGGCTGCTGTGTCTATGG + Intergenic
902229684 1:15020042-15020064 CCCCAGGGCCCCTGGGGCTGGGG - Intronic
902379606 1:16046483-16046505 CCCGAGGGCTGCAGAGGCTGTGG + Intronic
903034496 1:20485484-20485506 CCCGCGGGCTGCTGCGGCGGTGG + Exonic
903063155 1:20684199-20684221 CCTGTGGGCCCTTGGGGCTGAGG + Intronic
903187181 1:21635286-21635308 CCCCTGGGCTGCGGAGGCTGGGG - Intronic
903564076 1:24251405-24251427 GCGGTGGGGCGCTGTGGTTGTGG + Intergenic
912500825 1:110121022-110121044 CCTGCTGGCCGCTGTGGCTGTGG - Intergenic
912515682 1:110215278-110215300 CCCATGGGCAGCTGCTGCTGTGG + Intronic
914490347 1:148147342-148147364 CCCATGAGGCCCTGTGGCTGCGG + Intronic
914917606 1:151828020-151828042 TCCGTGGGGCCCTGTGGCTAGGG + Intronic
915065500 1:153221109-153221131 CCCTGTGGCCTCTGTGGCTGTGG - Intergenic
915458143 1:156053886-156053908 CGCCCGGGGCGCTGTGGCTGCGG - Intergenic
916211759 1:162365421-162365443 CCAGTTGGCTGCTGAGGCTGCGG + Exonic
918601956 1:186375046-186375068 CCCGTCGGCCGCTGCCACTGGGG - Exonic
921161900 1:212478849-212478871 CCCGTGGGATGCTCAGGCTGGGG - Intergenic
921390189 1:214607872-214607894 CCCATGAGGCCCTGTGGCTGCGG - Intronic
921711479 1:218377717-218377739 ACCCTGGGTAGCTGTGGCTGGGG + Intronic
922307592 1:224357329-224357351 CCCGAGGGCGGCCGTGGCTCAGG - Intronic
924436815 1:244049275-244049297 CCCGCGGGCCGGTGCAGCTGCGG + Intronic
1063076660 10:2723476-2723498 CCTGTGGACTGCTGTTGCTGTGG - Intergenic
1066298762 10:34078956-34078978 CCCGTGGGGAGCGTTGGCTGTGG - Intergenic
1067429403 10:46233242-46233264 CACCTGGGGGGCTGTGGCTGAGG - Intergenic
1071573767 10:86711643-86711665 CCCGGGGGGAGCTGCGGCTGCGG - Intronic
1072521326 10:96232422-96232444 CCGGTGGTCTGCTGTGGCAGGGG - Intronic
1072914760 10:99531079-99531101 ACCGGGCGCCCCTGTGGCTGAGG + Intergenic
1073051397 10:100669655-100669677 CCCGTGGGCCCGTGTGACAGTGG - Intergenic
1073338795 10:102729752-102729774 GCCCTTTGCCGCTGTGGCTGCGG + Exonic
1075727947 10:124620272-124620294 CCCGTGGGGCCCAGGGGCTGGGG - Exonic
1076373056 10:129967206-129967228 CCCGCGGGCCGCGACGGCTGCGG + Intergenic
1076876642 10:133219543-133219565 CCCGTGGACAGCTGTGGCTGGGG - Intronic
1077309871 11:1883524-1883546 CCTGGGGGCCGCAGGGGCTGAGG + Exonic
1078080968 11:8204573-8204595 CCCCATGGCCCCTGTGGCTGAGG + Intergenic
1081470823 11:43368893-43368915 CCCGAGGGCTGGTATGGCTGAGG - Intronic
1084086751 11:66858460-66858482 ACTGTGAGCTGCTGTGGCTGCGG + Exonic
1084769340 11:71332409-71332431 CCCACCTGCCGCTGTGGCTGGGG - Intergenic
1085022516 11:73218335-73218357 CACGTGGGTCTCTGCGGCTGCGG + Exonic
1088194686 11:107261524-107261546 CCCATGGACCACTGTGGCAGAGG - Intergenic
1089219358 11:116858075-116858097 CCCGTGGGGCGGGGTGGGTGAGG + Exonic
1089920256 11:122203078-122203100 CCGGAGGGCAGCTGGGGCTGCGG - Intergenic
1090660700 11:128879906-128879928 CCTGAGGGCCGCAGGGGCTGTGG + Intergenic
1090912027 11:131129482-131129504 GCTGTGGGCAGCAGTGGCTGTGG + Intergenic
1095989554 12:48025311-48025333 GCCGTGGGAGGCTGTGGGTGGGG + Exonic
1096601764 12:52734687-52734709 CCCATAGGGCCCTGTGGCTGGGG - Intergenic
1101739657 12:107491084-107491106 TAGGTGGGCCTCTGTGGCTGAGG + Intronic
1102318165 12:111906737-111906759 CCCATGGACTGCTGGGGCTGGGG + Intergenic
1103851094 12:123934227-123934249 CCTGTGAGCCGAAGTGGCTGGGG - Exonic
1104013287 12:124947043-124947065 CCCTTGTTCCTCTGTGGCTGAGG - Exonic
1104112481 12:125716924-125716946 CCAGGAGGCCCCTGTGGCTGGGG + Intergenic
1104653799 12:130557889-130557911 CCAGTGAGCAGCTGTGGCTTCGG + Intronic
1104978866 12:132564001-132564023 CCCCTCGGCTGCTGTGGCTGGGG + Intronic
1105476213 13:20730030-20730052 CTCCCGGGCCGCTGTGGCCGTGG + Intronic
1105541539 13:21320871-21320893 CCCGTGGGGGCCTCTGGCTGGGG - Intergenic
1107603952 13:42040582-42040604 CCCGTGGGAGGCTGCGGCGGTGG + Intronic
1108389674 13:49936091-49936113 CCCGTGAGCCGTTGGGTCTGGGG + Intronic
1113821385 13:113215998-113216020 CCCATGGTCCCATGTGGCTGTGG + Intronic
1113956994 13:114104371-114104393 CCAGTGGGTGTCTGTGGCTGGGG - Intronic
1115657612 14:35459023-35459045 CCCCTGGGCCTGAGTGGCTGGGG + Intergenic
1119325633 14:73758520-73758542 CCTGTTGGCAGCTGCGGCTGGGG - Intronic
1121501398 14:94441331-94441353 CCTGTGGGCAGATGTGGATGTGG - Intergenic
1122108690 14:99480568-99480590 CCCGCCGGCCGCTGTGGCCCCGG - Intronic
1122111858 14:99508838-99508860 CCTGTGGGCCCAGGTGGCTGTGG + Exonic
1122214078 14:100192277-100192299 CCCGTGAGGCGCGGGGGCTGGGG - Intergenic
1122817505 14:104320863-104320885 CCCGAGAGCTGCTGTGGCCGGGG + Intergenic
1122967730 14:105139094-105139116 CCCTGGGGCCCCTCTGGCTGTGG - Intergenic
1123110462 14:105864746-105864768 CCCGGGGGTCTGTGTGGCTGGGG - Intergenic
1202926257 14_KI270724v1_random:28557-28579 CCCGCGCGCCCCTGTGGCTGTGG - Intergenic
1124142117 15:27086873-27086895 CTTGTGGGCCACTGTGTCTGTGG + Intronic
1124291623 15:28457165-28457187 CCCATGAGGCCCTGTGGCTGTGG - Intergenic
1125464299 15:39935106-39935128 CCCATGGGCCGCTTTGAATGTGG - Intronic
1127766151 15:62187184-62187206 CTCATGTGCTGCTGTGGCTGTGG - Intergenic
1128482872 15:68054691-68054713 CCCATGGGGAGCTGGGGCTGGGG + Intronic
1129516474 15:76160550-76160572 CTCTTGGGCCGCTGTGGCTGTGG + Intronic
1129566142 15:76625366-76625388 CCTGTGGGCCGCTGAACCTGGGG - Intronic
1132657332 16:1046772-1046794 CCATTGTGCGGCTGTGGCTGTGG - Intergenic
1133207040 16:4240062-4240084 CTCGTGTGCAGCTCTGGCTGGGG - Intronic
1133286253 16:4692214-4692236 CCCGTGGGACGCAGGGGCAGAGG - Intergenic
1135429919 16:22374393-22374415 CCCGAGGGCGGCTCTGGCTGAGG - Exonic
1137755585 16:50899576-50899598 CCCGTGGGCCTCTCTTTCTGAGG + Intergenic
1139116485 16:63960582-63960604 CACTTGGGCAACTGTGGCTGGGG - Intergenic
1139851034 16:69951711-69951733 GCCGAGGGGCGCTGTGGCTGGGG + Intronic
1139880014 16:70174623-70174645 GCCGAGGAGCGCTGTGGCTGGGG + Intronic
1140372497 16:74420894-74420916 GCCGAGGAGCGCTGTGGCTGGGG - Intronic
1140486248 16:75295980-75296002 CCCTTGGGCTGGTGGGGCTGGGG - Intronic
1142029338 16:87830791-87830813 CCTGTTGGCTGCTGCGGCTGTGG - Exonic
1142196824 16:88742848-88742870 CCCCTGAGCAGCCGTGGCTGGGG + Intronic
1142215612 16:88828376-88828398 GCAGTGGGCAGCTGCGGCTGTGG + Intronic
1142690178 17:1601421-1601443 GCCGTGTGCCTCTCTGGCTGTGG - Intronic
1142888911 17:2930267-2930289 CACGTGGGAGCCTGTGGCTGGGG + Intronic
1142904820 17:3034533-3034555 CCCTTGGGCAGCTGCGTCTGGGG + Exonic
1143625797 17:8109652-8109674 CCCGTGGCCCGGCGGGGCTGGGG + Intronic
1145019101 17:19416049-19416071 CACAGGGGCCGCTGTGGTTGGGG + Exonic
1147139693 17:38454095-38454117 CGCGGCGGTCGCTGTGGCTGAGG - Intronic
1147430401 17:40367135-40367157 ACCCTGAGCCCCTGTGGCTGGGG - Intergenic
1148178530 17:45586884-45586906 CCTGTGGTCTGCTGGGGCTGAGG + Intergenic
1148270625 17:46259571-46259593 CCTGTGGTCTGCTGGGGCTGAGG - Intergenic
1148460574 17:47837054-47837076 CCCCAAGGCCTCTGTGGCTGAGG + Exonic
1150225316 17:63521611-63521633 CTCTTTGGCCACTGTGGCTGGGG - Intronic
1151569578 17:74919536-74919558 CCAGTGGGACGCTGATGCTGCGG + Exonic
1151718592 17:75843695-75843717 CCCTGGGCCCGCCGTGGCTGAGG + Intronic
1152296502 17:79470235-79470257 CATGTGGGCCACTGGGGCTGCGG - Intronic
1152741879 17:82022022-82022044 CTCGTGGGCCTCTGTGGCCTGGG - Intronic
1152938013 17:83151981-83152003 CCCATGGGCAGCTGGGGCTCTGG + Intergenic
1153514453 18:5891255-5891277 CCCGGGGGCTGCGGTGGCTCCGG - Exonic
1153551029 18:6262041-6262063 CCCGATGGCTGCTGTGGCTTAGG - Intronic
1153771919 18:8423452-8423474 CCCGGGGGCTGCTGTGGCCATGG - Intergenic
1154310284 18:13261993-13262015 CCCGTGGGGCTCTGTGCGTGGGG + Intronic
1155508234 18:26550964-26550986 CCCGGGGGCCGCGCTGGCTCCGG + Intronic
1160516248 18:79480688-79480710 CCCGAGAGCCGCTGGGGCTGGGG - Intronic
1160548775 18:79679989-79680011 CCCGACGGCGGCTGTGGCCGAGG + Exonic
1160931107 19:1569807-1569829 GCAGTGGGTGGCTGTGGCTGAGG - Intergenic
1160981550 19:1818747-1818769 CCCCCGGGCCGCTCTGGGTGCGG + Exonic
1160995263 19:1879478-1879500 CCCATGAGGCCCTGTGGCTGCGG - Intronic
1161208984 19:3056566-3056588 GCAGGGGGCCGCTGGGGCTGCGG + Intronic
1161412475 19:4124037-4124059 GCCGAGGGGCGCTGGGGCTGAGG + Exonic
1162122271 19:8478502-8478524 CCAGTGGGCCTCAGTGGCTGGGG + Intronic
1162481331 19:10928592-10928614 CACCTGGGCCGGCGTGGCTGGGG + Exonic
1162954323 19:14090032-14090054 TCCGGCGGCGGCTGTGGCTGCGG + Exonic
1163804149 19:19386012-19386034 CGCGGCGGCCGCTGTGGCGGCGG - Exonic
1164609241 19:29621074-29621096 CCAGCGGGGGGCTGTGGCTGTGG - Intergenic
1166308076 19:41946544-41946566 CCTAGGGGTCGCTGTGGCTGGGG - Intergenic
1166504829 19:43364664-43364686 GCCCTGGGCTGCTGTGGATGAGG - Intergenic
1166505711 19:43370250-43370272 GCCCTGGGCTGCTGTGGATGAGG + Intergenic
1167149715 19:47701780-47701802 CCCGTGGGCGGCGGTGGTGGTGG - Exonic
925333004 2:3073373-3073395 GCGGTGGGTCGCTGTGCCTGGGG - Intergenic
925345362 2:3168430-3168452 CCCCTGAGCCGCCGTGGCAGAGG - Intergenic
925607483 2:5673526-5673548 CCGGGCGGGCGCTGTGGCTGCGG - Intergenic
927152496 2:20203999-20204021 CTCCTGGGCCGTGGTGGCTGTGG + Exonic
927710922 2:25325418-25325440 ACCGTGGGCCGCTTCCGCTGTGG - Intronic
928176339 2:29036768-29036790 CACGTGGGCCTGTGTGGCTCTGG + Intronic
928606108 2:32946758-32946780 CCCGTGGGTCGCCGAGGCGGAGG - Intergenic
929861494 2:45681938-45681960 CCACTGGGGCGGTGTGGCTGGGG - Intronic
931517654 2:63059292-63059314 CCCCAGGGCCGCTTTGGCTCAGG + Intergenic
932567684 2:72919976-72919998 CCCGCGGGCCGCCGCGGCCGAGG + Intronic
933086424 2:78059517-78059539 CCCGTCTCCCGCAGTGGCTGTGG - Intergenic
933773514 2:85758465-85758487 GCTGTGTGCCGCTGTTGCTGCGG + Intronic
936487602 2:112939672-112939694 CCAGTGAGCAGCTGTGGCTCTGG + Intergenic
937288472 2:120767706-120767728 CACGCAGGCCACTGTGGCTGGGG - Intronic
938325193 2:130393699-130393721 CCTGTGGTCCGCGGTGGCTCAGG + Intergenic
944531716 2:200674096-200674118 GGCGTGGGCCACTGTGTCTGGGG - Intronic
944579155 2:201116915-201116937 CGGGTGGGCCTCTGGGGCTGCGG - Intronic
946865541 2:224038897-224038919 CCCGCGGGCCGCCTTGGCCGGGG - Intronic
947201027 2:227614821-227614843 ACCATGGGCTGCTGTGGTTGTGG - Intronic
949031692 2:241800135-241800157 TCCGTGGGGCCCTGAGGCTGGGG + Intronic
1169042823 20:2509623-2509645 CCCGAGGGAGGCTGAGGCTGAGG + Intronic
1171782345 20:29430683-29430705 CCCGCGCGCCCCCGTGGCTGTGG + Intergenic
1172876340 20:38166531-38166553 CCCGTGGGCCTCTGTCTCTCCGG - Intronic
1173479803 20:43390011-43390033 CCTGTGGGTGGCTGTGGCTGTGG - Intergenic
1175089581 20:56490910-56490932 CCCAGGAGCCCCTGTGGCTGTGG + Intronic
1175220233 20:57412451-57412473 CTCGTGGGCTGCGGTGGCTGTGG - Intergenic
1175304067 20:57964046-57964068 GCGCCGGGCCGCTGTGGCTGTGG - Intergenic
1175338196 20:58210131-58210153 CCTGTGGGCCGCTGGGGCTGGGG + Intergenic
1175689375 20:61054561-61054583 GCAGTGGGCCTCTGAGGCTGAGG - Intergenic
1175885638 20:62288823-62288845 CCTGTGGGCAGGTGTGGCTGAGG + Intronic
1176155494 20:63618048-63618070 CCCTTGGGACGCCGTGGCCGCGG - Intronic
1176244830 20:64092554-64092576 CCCGTGTGCCTCAGTGTCTGTGG + Intronic
1176309566 21:5142491-5142513 CCCATTGGCCTCTGTGCCTGGGG - Intronic
1179825412 21:43962666-43962688 CCCTTGGGCAGCTGTAGCAGAGG + Intronic
1179847494 21:44119542-44119564 CCCGTTGGCCTCTGTGCCTGGGG + Intronic
1179903588 21:44407617-44407639 TTCGTGGGTGGCTGTGGCTGAGG - Intronic
1180113157 21:45675262-45675284 CTCTTGGGCAGCTGAGGCTGAGG + Intronic
1180185845 21:46138835-46138857 ACCGTGGGCCTCTGTGTCTGGGG - Intronic
1180966385 22:19789962-19789984 CCCTTGGCACCCTGTGGCTGTGG - Intronic
1180975759 22:19847213-19847235 CCTGTGGGCCACCGTGGCTGGGG - Exonic
1181033088 22:20157545-20157567 TCAGTGGGCAGCTGGGGCTGGGG + Intergenic
1181121340 22:20670018-20670040 CCCATGAGGCCCTGTGGCTGCGG - Intergenic
1181335220 22:22124122-22124144 GCTGTGGGCCACTGTGGCTCCGG - Intergenic
1181510221 22:23385692-23385714 TCAGTGGGCAGCTGGGGCTGGGG - Intergenic
1182269014 22:29141759-29141781 CCTGTGGGCAGCAGGGGCTGAGG - Intronic
1182487269 22:30646985-30647007 CCCGTCGGGGGCTGTGGCGGAGG + Exonic
1183598826 22:38828350-38828372 GCCGGCGGCTGCTGTGGCTGAGG + Exonic
1183784772 22:40023033-40023055 CCTGGGCGCCTCTGTGGCTGTGG + Intronic
1184171033 22:42759913-42759935 CCAGTGGTCCGGTGTGGATGAGG - Intergenic
1184255943 22:43287053-43287075 CGGGTGGGCCCCTGGGGCTGTGG + Intronic
1185315753 22:50178455-50178477 CCCGTGGGCCGCTGTGGCTGTGG - Intronic
1185397701 22:50601085-50601107 CCCGGGGGTCACTGAGGCTGGGG - Intronic
949245562 3:1922517-1922539 CCCGTGGGCCTCTGAAGGTGAGG + Intergenic
949534483 3:4985488-4985510 ACCGTGGGCAGCAGTGTCTGGGG + Intergenic
950431647 3:12954378-12954400 CCCGAGGGCCTTGGTGGCTGTGG + Intronic
952846400 3:37691204-37691226 CCTGTGGGCCTCTCTGGCAGAGG - Intronic
952900258 3:38107775-38107797 TATGTGGGCCTCTGTGGCTGAGG - Intronic
953253242 3:41265195-41265217 GCCGTGGCCCCCTGTGGCCGTGG - Intronic
953980389 3:47410471-47410493 GCCGTGGGGCTGTGTGGCTGGGG - Exonic
954582210 3:51709019-51709041 GCTGTGGGGTGCTGTGGCTGAGG + Exonic
957083147 3:75655699-75655721 CCCGCGCGCCCCCGTGGCTGTGG - Intergenic
958641574 3:96813630-96813652 CCCCTGCGCTGCTGTGGATGTGG + Intergenic
961013427 3:123449879-123449901 CCCGCGGGGCGCCGAGGCTGGGG - Intergenic
962249403 3:133826183-133826205 CCCCTTGGCCTCTGAGGCTGAGG - Exonic
964470273 3:157045655-157045677 CCCCTGGGAGGATGTGGCTGGGG - Intronic
966850337 3:184160978-184161000 TCCGAGGGTCGCTGTGGCTCTGG + Intronic
967723937 3:192844139-192844161 CCCGTGGGCTGGCGAGGCTGCGG - Intronic
968051241 3:195656432-195656454 ACTGTGGGCTGCTGCGGCTGAGG + Intergenic
968104582 3:195991906-195991928 ACTGTGGGCTGCTGCGGCTGAGG - Intergenic
968302873 3:197629489-197629511 ACTGTGGGCTGCTGCGGCTGAGG - Intergenic
968491028 4:890543-890565 CCCGTGGGCCCCGCTGGCAGTGG - Exonic
969600054 4:8170891-8170913 CCCATGGGTCACTGTGCCTGTGG - Intergenic
969676052 4:8614956-8614978 CTCGAGAGCCGCTGGGGCTGTGG + Intronic
969987982 4:11231383-11231405 CCCTTGTGCGGCTCTGGCTGGGG + Intergenic
970593289 4:17577611-17577633 CCCGTGGGCTACTGGGGCTGCGG + Intronic
972148892 4:36064579-36064601 CAGGTGGGCTGCTCTGGCTGTGG + Intronic
975043552 4:69773918-69773940 CCCCAGGGCTGCTCTGGCTGTGG + Intronic
981485296 4:145279614-145279636 GCCTTGGTCCGCTTTGGCTGAGG + Intergenic
985507930 5:295072-295094 ACTGTGGGCTGCTGCGGCTGAGG + Intronic
996811087 5:127517297-127517319 CCCTTGGGCCGCTGTGGCACAGG + Intergenic
998266513 5:140671316-140671338 CCTGTGGTCTGCTGGGGCTGAGG - Exonic
998407040 5:141879822-141879844 CCCCTGGGCTCCTGGGGCTGAGG - Intergenic
998449365 5:142222543-142222565 CCAGAAGGCTGCTGTGGCTGGGG - Intergenic
999228707 5:150048795-150048817 CCCGTGGGCAGCTATGCCGGAGG - Intronic
999233299 5:150075416-150075438 CAAGTGGGCCAGTGTGGCTGCGG - Intronic
1001400120 5:171441416-171441438 CCGGAAGGCTGCTGTGGCTGTGG - Intronic
1002251265 5:177930740-177930762 GCCGTGGGCTGCTGGGGGTGGGG - Intergenic
1002645558 5:180651433-180651455 CCCGGGGGGTGCTGAGGCTGCGG - Intergenic
1003173723 6:3739463-3739485 CGCCTGGGCCTGTGTGGCTGAGG - Intronic
1004241321 6:13924980-13925002 CCCGGGAGCCGCTCCGGCTGCGG - Exonic
1007575937 6:42925267-42925289 CGGGTGGGGCGCTGTGGCTGGGG + Exonic
1009739287 6:67723227-67723249 CCAGTGGGCCGGTGCTGCTGGGG - Intergenic
1011519967 6:88194503-88194525 CAAGTGGGCTCCTGTGGCTGAGG - Intergenic
1014947583 6:127516031-127516053 CCCCTGGGCGGCGGCGGCTGCGG + Exonic
1017212549 6:151872853-151872875 CCCTTGTACCGTTGTGGCTGGGG + Intronic
1017786698 6:157762672-157762694 CCCGGAGCCCGCTGTGGCTAGGG + Intronic
1018430023 6:163714721-163714743 CCCCTGGGCCGCAGTGACTCTGG + Intergenic
1019337958 7:494137-494159 GGCGTCGGCCGCTGGGGCTGGGG + Intergenic
1019474221 7:1236314-1236336 GCCAGGGGCCGCTGTGGCGGCGG + Exonic
1019641802 7:2107288-2107310 CCCCAGGGCTGCTGTGGCTTGGG - Intronic
1019735844 7:2649404-2649426 GCTGTGGGCAGCTCTGGCTGAGG + Intronic
1024364408 7:48504712-48504734 CCCGTGGACCACTGGTGCTGTGG - Intronic
1027184506 7:75962839-75962861 ACCGTGGGCTGCTGTGCCAGCGG + Intronic
1028153961 7:87408095-87408117 CTGGTGGGCAGCAGTGGCTGTGG - Exonic
1028163817 7:87515289-87515311 CTGGTGGGCAGCAGTGGCTGTGG - Exonic
1032117005 7:129126334-129126356 GCCGAGGGGCGCTGGGGCTGAGG - Intergenic
1033249637 7:139747636-139747658 CACCTAGGCCCCTGTGGCTGAGG + Intronic
1033548479 7:142423964-142423986 CCCATGGGAGGCCGTGGCTGGGG - Intergenic
1035056859 7:156041605-156041627 CCCAGGGGCTGCTGTGGCCGGGG - Intergenic
1035382021 7:158446434-158446456 GCCGGGGGCAGCTGTGGCTTGGG - Intronic
1035712438 8:1729130-1729152 TGCGTGGGCTGCTGTGGCTCTGG + Intergenic
1035734860 8:1880909-1880931 CCAGGGGGCGGCTGTGGCTGTGG - Intronic
1046016861 8:108615725-108615747 CCCGTGGGGAGCTCTGGATGTGG + Intronic
1049367968 8:142249856-142249878 ACCATGGGCCGGTCTGGCTGTGG - Intronic
1049617857 8:143583689-143583711 CCCCTAGGTGGCTGTGGCTGTGG + Intronic
1049683010 8:143928057-143928079 ACCCTGGGTCGCTGTGGCTTGGG - Intronic
1049694313 8:143976164-143976186 ACTGTGGGCCGCTGGAGCTGCGG - Intronic
1050437762 9:5628593-5628615 GCTGCCGGCCGCTGTGGCTGTGG - Intergenic
1055701092 9:78946727-78946749 CCCTTGGACTGCTGTGCCTGTGG - Intergenic
1056845401 9:90033104-90033126 CCCGTGTGACGCTGTGGTGGTGG + Intergenic
1057018661 9:91678607-91678629 CCTGTGGGCCTCTGTTACTGTGG + Intronic
1057029959 9:91768074-91768096 CCCATGGTGCTCTGTGGCTGTGG - Intronic
1057230450 9:93318539-93318561 CCAGTGGGCTGCTGTGAGTGAGG + Exonic
1057242489 9:93423636-93423658 CCCAAGGGCAGCAGTGGCTGGGG + Intergenic
1057371892 9:94480665-94480687 ACCGTGGGCCTCAGTGGCAGCGG + Intergenic
1057957977 9:99426643-99426665 CCTGCTGGCAGCTGTGGCTGAGG - Intergenic
1058861308 9:109119918-109119940 CTCGGGGGCGGCTGTGGCGGAGG - Exonic
1058907307 9:109492242-109492264 CCCTTGAGCTGATGTGGCTGAGG + Intronic
1059399376 9:114059315-114059337 CCCGATGGCTGCTGTGGCTGTGG - Intergenic
1059408737 9:114118705-114118727 GCTGTGGGGGGCTGTGGCTGGGG + Intergenic
1060280615 9:122213525-122213547 CACGTGGGCGGCTGAGGCCGAGG - Intronic
1060665278 9:125428847-125428869 CCCCTGGGCCACCGTGGGTGAGG - Intergenic
1061365757 9:130171996-130172018 CCCGTGGGCCGCCGTGTCCCCGG + Intergenic
1061481474 9:130899508-130899530 CCTGTGGGTCCCTGTGGCTGGGG - Intergenic
1062272140 9:135714459-135714481 CCGGTGGGTCGCGGTGGCCGCGG + Intronic
1062436314 9:136548006-136548028 CCCATGGACAGCTGTGGCCGAGG + Intergenic
1062474521 9:136720514-136720536 CCCGTGGGGCGCTGGGATTGAGG + Intronic
1185457224 X:317240-317262 CTCGTGTCCCGCTGTGGCTCCGG - Intronic
1189407092 X:40735295-40735317 CCCGGGAGCCGCCGTGGCGGCGG - Exonic
1190339576 X:49286184-49286206 CCTACGGGCTGCTGTGGCTGCGG + Exonic
1190881712 X:54496205-54496227 TCCCAGTGCCGCTGTGGCTGCGG - Intergenic
1196828612 X:119759315-119759337 CCCGGTGGCCGCTGTGGTCGCGG - Exonic
1200000190 X:153056250-153056272 CCCGGGGGCCCCCGTGGCGGGGG + Intergenic
1201896133 Y:18994378-18994400 CCTGTGGGCCACTGTGGAGGTGG + Intergenic