ID: 1185318468

View in Genome Browser
Species Human (GRCh38)
Location 22:50189411-50189433
Sequence TGCTCGGTGGACGTCCGTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185318458_1185318468 9 Left 1185318458 22:50189379-50189401 CCACAAATCGTGTTCAGCACCCA No data
Right 1185318468 22:50189411-50189433 TGCTCGGTGGACGTCCGTGCGGG No data
1185318457_1185318468 10 Left 1185318457 22:50189378-50189400 CCCACAAATCGTGTTCAGCACCC No data
Right 1185318468 22:50189411-50189433 TGCTCGGTGGACGTCCGTGCGGG No data
1185318455_1185318468 30 Left 1185318455 22:50189358-50189380 CCCATGCTCAGGAGGCATGTCCC No data
Right 1185318468 22:50189411-50189433 TGCTCGGTGGACGTCCGTGCGGG No data
1185318460_1185318468 -10 Left 1185318460 22:50189398-50189420 CCCACCCCAGTCCTGCTCGGTGG No data
Right 1185318468 22:50189411-50189433 TGCTCGGTGGACGTCCGTGCGGG No data
1185318456_1185318468 29 Left 1185318456 22:50189359-50189381 CCATGCTCAGGAGGCATGTCCCA No data
Right 1185318468 22:50189411-50189433 TGCTCGGTGGACGTCCGTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185318468 Original CRISPR TGCTCGGTGGACGTCCGTGC GGG Intronic