ID: 1185318878

View in Genome Browser
Species Human (GRCh38)
Location 22:50191117-50191139
Sequence GGTGCAATGGGGCCATGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185318878_1185318893 19 Left 1185318878 22:50191117-50191139 CCCGACCATGGCCCCATTGCACC 0: 1
1: 0
2: 3
3: 7
4: 130
Right 1185318893 22:50191159-50191181 AGTTCCTCTCCCAGAAGTCCCGG No data
1185318878_1185318884 -6 Left 1185318878 22:50191117-50191139 CCCGACCATGGCCCCATTGCACC 0: 1
1: 0
2: 3
3: 7
4: 130
Right 1185318884 22:50191134-50191156 TGCACCACCCACCCCAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185318878 Original CRISPR GGTGCAATGGGGCCATGGTC GGG (reversed) Intronic
900086928 1:903156-903178 GGTGAAATGGGGTCATGGGGCGG - Intergenic
902071642 1:13744463-13744485 GGTGGTATGGTGTCATGGTCAGG + Intronic
911145786 1:94551261-94551283 GGGGCAATGGGCCTGTGGTCTGG + Intergenic
911315630 1:96353271-96353293 GATGCACTGGGGCCAGGGTTGGG - Intergenic
911949714 1:104156470-104156492 GGTGCAAAGTACCCATGGTCAGG + Intergenic
917508342 1:175649115-175649137 GGACCAATTCGGCCATGGTCAGG + Intronic
919869895 1:201812410-201812432 GTGGCAATGGGGACATTGTCAGG - Intronic
921568979 1:216755935-216755957 TGTGCAGGGGGGCCAGGGTCAGG - Intronic
922217049 1:223528407-223528429 GGTTTAATGGGGCAATGGACAGG - Intergenic
1062876046 10:943746-943768 GGTGCAGGGGGGCCCAGGTCAGG + Intergenic
1064818958 10:19301836-19301858 GGTTCAATGGGTCCATGGGCAGG - Intronic
1069820624 10:71225468-71225490 TGTGCAATGGGGTCAGGGTATGG - Intronic
1070148127 10:73789340-73789362 GGAGAAATGGGGGCATGGTCAGG - Intronic
1070550522 10:77487531-77487553 GGTGCAATGGGGGTGTGGTAAGG - Intronic
1070901057 10:80029456-80029478 GGAGCCAAGGGGCCATGGTGGGG - Intergenic
1070902786 10:80045213-80045235 GGAGCCAAGGGGCCATGGTGGGG - Intergenic
1072310350 10:94148372-94148394 GGTGCATTGGGCCCTAGGTCAGG + Intronic
1074213367 10:111359906-111359928 GGGTCAATAGGGCCATGGTGTGG + Intergenic
1081426462 11:42931428-42931450 GGTTAAATGAGGCCATGGACTGG + Intergenic
1083617701 11:64034788-64034810 GGAGCACTGGGGCCCTGGTGGGG + Intronic
1084377037 11:68784637-68784659 AGAGCAATGGGGACATGGTGGGG - Intronic
1089539693 11:119182352-119182374 GGGGCAATGGGACCAGGGACAGG - Intronic
1090137297 11:124210721-124210743 GGTGACATGGGGCCAGGGTCAGG + Intergenic
1092780063 12:11978177-11978199 GGTGCAATTGAAACATGGTCAGG + Intergenic
1095040727 12:37437444-37437466 TTTGCTATTGGGCCATGGTCAGG - Intergenic
1096114076 12:49044879-49044901 TGTGCAGTGGTGACATGGTCAGG + Exonic
1101044872 12:100794690-100794712 GGTGCAGGGGAGGCATGGTCGGG - Intronic
1101480584 12:105092778-105092800 GGTGAAATGGCTCCATTGTCTGG - Intergenic
1102171206 12:110843851-110843873 GGGTCCAGGGGGCCATGGTCAGG - Intergenic
1109744414 13:66604106-66604128 GGAGGAATGGGGCCGTGGTGAGG - Intronic
1110739859 13:78981894-78981916 GGAGCACTGGGGCAGTGGTCAGG + Intergenic
1113437947 13:110307553-110307575 GGTGCTCTCGGGCCAGGGTCTGG - Intronic
1114037887 14:18646414-18646436 AGGGCGATGGGGCCTTGGTCCGG - Intergenic
1114120734 14:19668614-19668636 AGGGCGATGGGGCCGTGGTCCGG + Intergenic
1114460813 14:22885045-22885067 GGGGCTCTGGGGCCCTGGTCAGG + Intronic
1118480770 14:66162854-66162876 GGTGAACTGGGGTCATGGTGGGG + Intergenic
1118858548 14:69643544-69643566 GGTTTAATGGGACCATGATCAGG - Intronic
1122969531 14:105146899-105146921 GGTGCTGTTGGGCCAGGGTCAGG - Intronic
1126118323 15:45228908-45228930 GGTGAAATGGGGGCATGGGAAGG - Intergenic
1129460657 15:75698610-75698632 GGTGCGCTGGGTCCCTGGTCTGG + Intronic
1129724211 15:77893430-77893452 CATGCACTGGGTCCATGGTCTGG - Intergenic
1130040063 15:80398975-80398997 GGTGCTTTGGGTCCATGCTCGGG + Intronic
1130438558 15:83927037-83927059 GGAGCATGGGGGCCATGGTTGGG - Intronic
1132672284 16:1106752-1106774 GATGCAGTGGGGGCATGGGCAGG - Intergenic
1135136779 16:19890831-19890853 GGACCAATGGGGCCATGATGAGG - Intergenic
1135993111 16:27229375-27229397 GCTCCCATGGGGCCATGGTCTGG - Intronic
1137749546 16:50849374-50849396 GTTGCACAGGGGCCATGGACAGG - Intergenic
1138415261 16:56867971-56867993 TGACCACTGGGGCCATGGTCGGG + Intronic
1138443260 16:57047523-57047545 GCTGCAAAGGGGCAATGGGCAGG - Exonic
1141573447 16:84948586-84948608 GCTGAAATGGGGCCCTGGCCAGG + Intergenic
1141680561 16:85541430-85541452 GGGGCAGTGGGGACACGGTCAGG - Intergenic
1144835793 17:18156072-18156094 GGCACAATGGGGCCAAGGTGGGG + Intronic
1146821240 17:35984929-35984951 GGTTCAATGGGGACATGGGCAGG - Intronic
1147587345 17:41660101-41660123 GGAGGAATGGGGCCAGGGGCAGG - Intergenic
1147998120 17:44372429-44372451 GGTACACGGGGGCCAAGGTCAGG + Intronic
1148205534 17:45777462-45777484 GGAGCACTGGGGCCATGGGAAGG - Intergenic
1148790358 17:50169238-50169260 GGTGCAATGTGACCCTGGTGAGG + Exonic
1152228310 17:79102708-79102730 GGTGGAGTGGGGCCAAGGTGGGG + Intronic
1152819376 17:82428729-82428751 GGTGCAGCGGGCCCATGGTTGGG + Intronic
1154328044 18:13406296-13406318 GGTGCCAAGGTGCCATGGGCTGG + Intronic
1155908665 18:31483568-31483590 GTTGCAATAGGGTCATGGGCAGG + Intergenic
1159196675 18:65124762-65124784 CATGCTATGGGGCCATGGTAGGG - Intergenic
1160099071 18:75903631-75903653 GGTGCAAGGGTGCCCTGCTCTGG + Intergenic
1160938807 19:1610403-1610425 GGTGTAATGGGGACATGGTGGGG + Exonic
1163764140 19:19153054-19153076 GGTGGACGGGGGCCTTGGTCCGG + Intronic
1165475284 19:36026784-36026806 CGTGCACTGGGCCCATGCTCTGG - Intronic
1166095815 19:40538429-40538451 CCTGCTATGGTGCCATGGTCTGG - Intronic
1168699860 19:58431246-58431268 AGGGCAAGGGTGCCATGGTCAGG + Intergenic
927239007 2:20903309-20903331 TGTGCAGTGGGGCCAAGGGCTGG - Intergenic
933978064 2:87527891-87527913 GGTGCTAGGGGGCCAGGGTGGGG - Intergenic
937038021 2:118797830-118797852 GGTGTGAGGGAGCCATGGTCAGG - Intergenic
937353034 2:121179270-121179292 AATGCAATGGGGCCATGATATGG + Intergenic
940129820 2:150368694-150368716 GGTGCAATGGAGGCATCATCAGG + Intergenic
944663833 2:201942679-201942701 AGTGCAGTGGGGCCAAGATCTGG + Intergenic
945120829 2:206455353-206455375 AGAGCAATGGGGCCCAGGTCTGG + Intronic
946365914 2:219248941-219248963 GGTGCAAGGGGCCCAAAGTCAGG + Exonic
948886646 2:240888222-240888244 GGTGGAATGGAGCCCTGGCCTGG - Intronic
1170820561 20:19753792-19753814 GGTGAAATGGGGGAATGGTAAGG + Intergenic
1172947500 20:38700696-38700718 GGAGCAATGTCGGCATGGTCAGG + Intergenic
1175225615 20:57442231-57442253 GGTGTGATGGGGGCATGGTGAGG + Intergenic
1175968198 20:62670439-62670461 GGTGCTTTGGGGCCATGATTAGG - Intronic
1180462014 22:15573456-15573478 AGGGCGATGGGGCCTTGGTCCGG - Intergenic
1185318878 22:50191117-50191139 GGTGCAATGGGGCCATGGTCGGG - Intronic
953741526 3:45542994-45543016 GGTGCAGAGGGGCCAGGGCCTGG - Intronic
953949835 3:47180764-47180786 AGAGCAATGGGACCTTGGTCAGG - Intergenic
954643855 3:52118671-52118693 GCTGGAATGGGGACATGGTGAGG + Intronic
960974173 3:123159272-123159294 GGTGCTATGGGGCCCTGCCCAGG - Intronic
961819747 3:129569915-129569937 GCTGCAGTGTGGCGATGGTCTGG + Exonic
966946553 3:184781037-184781059 GTTGCACTGGGGCCGAGGTCTGG - Intergenic
972048284 4:34695941-34695963 GGAGCAACGGGGTGATGGTCGGG - Intergenic
972298265 4:37761096-37761118 TGTGCAATGTAGCCAGGGTCAGG - Intergenic
975321006 4:73010894-73010916 GGTGATGTGGGGCCAGGGTCTGG - Intergenic
976756395 4:88502450-88502472 GGTTCCGTGGGGCCAGGGTCAGG + Intronic
982228043 4:153183545-153183567 GGTGCTATGGGACCAGGTTCTGG + Intronic
983055624 4:163096148-163096170 GGTAAAATGGGGGCATGGTAAGG - Intergenic
986806785 5:11314809-11314831 GCTGCAATGGGGACATGATTTGG + Intronic
988781860 5:34529592-34529614 GGTGGAGTGGGGCCGTGGCCTGG - Intergenic
989240859 5:39201970-39201992 GGGGCCATGGGGCCAAAGTCAGG - Exonic
991315773 5:65304442-65304464 GGTGCAAGGGGGCCAGGGTCTGG + Intronic
991427565 5:66507226-66507248 GTGGCAATGGGCCCATGCTCAGG - Intergenic
994245669 5:97472256-97472278 AGTGACATGGGGCCAGGGTCTGG + Intergenic
996203116 5:120700223-120700245 GGTAAAATGGGGGCATTGTCAGG + Intergenic
997622118 5:135305703-135305725 GGTGGAATGGGGCCAGGTCCTGG + Intronic
999280458 5:150361926-150361948 AGAGCAGTGGGGCCATGGTAGGG + Intronic
999619950 5:153462741-153462763 GCTGCAAAGGGGCCATGGGAAGG - Intergenic
1000246545 5:159453103-159453125 GGTGCAATTGGGCCATGGGCAGG - Intergenic
1001383278 5:171317813-171317835 GGTCCAGTGGGGACATGGCCTGG - Intergenic
1002166602 5:177351553-177351575 GGTGTAGTGGGGCCAGGGCCGGG + Exonic
1006066239 6:31464393-31464415 GGTGCAGTGTGGCCATGCTGTGG - Intergenic
1007050494 6:38823438-38823460 TGTGCAATGGGGCCAGTGGCTGG - Intronic
1010902996 6:81450955-81450977 GGTGCAGTGGGGCCATGGTAGGG - Intergenic
1011175140 6:84551855-84551877 GGACCAATGAGGCCATGGTAAGG - Intergenic
1016372207 6:143386811-143386833 GGTTCAAGGGGTCCATGTTCAGG + Intergenic
1017947124 6:159104713-159104735 GATGCAATGTGGCTATGGTGAGG + Intergenic
1018800480 6:167218280-167218302 TGTGCACTGGAGCCATGGCCCGG + Intergenic
1018809684 6:167289078-167289100 TGTGCACTGGAGCCATGGCCTGG - Intronic
1019490675 7:1311797-1311819 GGGGCATTGGAGCCATGGGCTGG + Intergenic
1019505183 7:1386930-1386952 GGGGCAATGGTGGCCTGGTCAGG + Intergenic
1023515125 7:40994185-40994207 GGGGCCATGGGGTCATGCTCTGG - Intergenic
1023686854 7:42744786-42744808 GCAGCAGTGGGGTCATGGTCTGG + Intergenic
1025286784 7:57669080-57669102 TTTGCTATTGGGCCATGGTCAGG - Intergenic
1028348584 7:89814773-89814795 GCTGAACTGGTGCCATGGTCAGG + Intergenic
1028447747 7:90944435-90944457 GGTGAAATGTGGCCATGGCCAGG + Intronic
1031004812 7:116458577-116458599 GGTGAAATGGGGGAATGGTAAGG - Intronic
1035277808 7:157758464-157758486 GCTGCACGGGGGCCACGGTCTGG - Intronic
1038328054 8:26587405-26587427 GGTGACATGGTGACATGGTCTGG - Intronic
1040296710 8:46152648-46152670 GCAGCAATGGGGCCACAGTCAGG - Intergenic
1042118028 8:65454016-65454038 GGTGTCATGGTGCCATGGTAAGG - Intergenic
1042791503 8:72612198-72612220 GTTGGAATGGGGCAATAGTCAGG - Intronic
1046395576 8:113633990-113634012 AGTGACATGGGGCCAGGGTCTGG + Intergenic
1050062855 9:1728653-1728675 GGTGCAATGGGCGCATGGGGTGG + Intergenic
1055779048 9:79799448-79799470 GGTGCAATGGTGGGATGGTGGGG - Intergenic
1059156893 9:111997987-111998009 TGTGAATTGGGGCCATGATCAGG + Intergenic
1060982519 9:127802067-127802089 TCTGCCATGGGGCCAGGGTCGGG + Intronic
1062397763 9:136359285-136359307 GGGGCTGTGGGGCCATGGTAGGG - Exonic
1062678381 9:137762054-137762076 GCTGCAGCAGGGCCATGGTCAGG - Intronic
1188621107 X:32225337-32225359 GGTGTAATTGGCCCATGGGCAGG + Intronic
1190915247 X:54807633-54807655 GGGGCAATGGGGCCCCGCTCAGG - Exonic
1192088681 X:68129257-68129279 GGTGCACTGGGGTCATGATTTGG + Intronic
1192204906 X:69089333-69089355 GGGGCTATGGGGCCAGGGTGGGG - Intergenic
1197913723 X:131513370-131513392 GGTGCAATGGGCCCAGGATGGGG + Intergenic