ID: 1185320518

View in Genome Browser
Species Human (GRCh38)
Location 22:50198441-50198463
Sequence ACAGGACCAGGCTCGCGGTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 95}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185320518_1185320529 24 Left 1185320518 22:50198441-50198463 CCGCACCGCGAGCCTGGTCCTGT 0: 1
1: 0
2: 1
3: 5
4: 95
Right 1185320529 22:50198488-50198510 TGCAGAGGGTGACCGAGGCCCGG 0: 1
1: 0
2: 0
3: 40
4: 251
1185320518_1185320526 10 Left 1185320518 22:50198441-50198463 CCGCACCGCGAGCCTGGTCCTGT 0: 1
1: 0
2: 1
3: 5
4: 95
Right 1185320526 22:50198474-50198496 CGCGCAGTACTGCCTGCAGAGGG 0: 1
1: 0
2: 0
3: 7
4: 76
1185320518_1185320525 9 Left 1185320518 22:50198441-50198463 CCGCACCGCGAGCCTGGTCCTGT 0: 1
1: 0
2: 1
3: 5
4: 95
Right 1185320525 22:50198473-50198495 CCGCGCAGTACTGCCTGCAGAGG 0: 1
1: 0
2: 0
3: 1
4: 80
1185320518_1185320527 19 Left 1185320518 22:50198441-50198463 CCGCACCGCGAGCCTGGTCCTGT 0: 1
1: 0
2: 1
3: 5
4: 95
Right 1185320527 22:50198483-50198505 CTGCCTGCAGAGGGTGACCGAGG 0: 1
1: 0
2: 1
3: 29
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185320518 Original CRISPR ACAGGACCAGGCTCGCGGTG CGG (reversed) Exonic