ID: 1185322657

View in Genome Browser
Species Human (GRCh38)
Location 22:50209084-50209106
Sequence GAGATGCTGAGTGCCCACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185322648_1185322657 7 Left 1185322648 22:50209054-50209076 CCCAGGGCAGCCAGCCGGGTCCT 0: 1
1: 0
2: 3
3: 28
4: 240
Right 1185322657 22:50209084-50209106 GAGATGCTGAGTGCCCACCTGGG No data
1185322649_1185322657 6 Left 1185322649 22:50209055-50209077 CCAGGGCAGCCAGCCGGGTCCTG 0: 1
1: 0
2: 5
3: 39
4: 339
Right 1185322657 22:50209084-50209106 GAGATGCTGAGTGCCCACCTGGG No data
1185322653_1185322657 -3 Left 1185322653 22:50209064-50209086 CCAGCCGGGTCCTGACTGGGGAG 0: 1
1: 0
2: 0
3: 17
4: 157
Right 1185322657 22:50209084-50209106 GAGATGCTGAGTGCCCACCTGGG No data
1185322654_1185322657 -7 Left 1185322654 22:50209068-50209090 CCGGGTCCTGACTGGGGAGATGC 0: 1
1: 0
2: 1
3: 16
4: 168
Right 1185322657 22:50209084-50209106 GAGATGCTGAGTGCCCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185322657 Original CRISPR GAGATGCTGAGTGCCCACCT GGG Intronic
No off target data available for this crispr