ID: 1185323695

View in Genome Browser
Species Human (GRCh38)
Location 22:50215468-50215490
Sequence GTGCCAGGTGTGGGTCCGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185323685_1185323695 25 Left 1185323685 22:50215420-50215442 CCTGTGCTGGGGGCAGCATTTGG 0: 1
1: 0
2: 4
3: 24
4: 259
Right 1185323695 22:50215468-50215490 GTGCCAGGTGTGGGTCCGTGTGG No data
1185323691_1185323695 0 Left 1185323691 22:50215445-50215467 CCGTGTGGGTCTCTGTGGCATGC 0: 1
1: 0
2: 5
3: 25
4: 247
Right 1185323695 22:50215468-50215490 GTGCCAGGTGTGGGTCCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185323695 Original CRISPR GTGCCAGGTGTGGGTCCGTG TGG Intronic
No off target data available for this crispr