ID: 1185325246

View in Genome Browser
Species Human (GRCh38)
Location 22:50222350-50222372
Sequence ATGCTCTTCTAGGAGAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 161}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185325246_1185325255 26 Left 1185325246 22:50222350-50222372 CCAGCCCTCTCCTAGAAGAGCAT 0: 1
1: 0
2: 2
3: 11
4: 161
Right 1185325255 22:50222399-50222421 TTTCCAGACCCCCAAAGCCCAGG 0: 1
1: 0
2: 3
3: 24
4: 258
1185325246_1185325251 0 Left 1185325246 22:50222350-50222372 CCAGCCCTCTCCTAGAAGAGCAT 0: 1
1: 0
2: 2
3: 11
4: 161
Right 1185325251 22:50222373-50222395 GTAGGTTTGTGTGCAGTCTCAGG 0: 1
1: 0
2: 1
3: 12
4: 112
1185325246_1185325253 2 Left 1185325246 22:50222350-50222372 CCAGCCCTCTCCTAGAAGAGCAT 0: 1
1: 0
2: 2
3: 11
4: 161
Right 1185325253 22:50222375-50222397 AGGTTTGTGTGCAGTCTCAGGGG 0: 1
1: 1
2: 1
3: 18
4: 178
1185325246_1185325257 28 Left 1185325246 22:50222350-50222372 CCAGCCCTCTCCTAGAAGAGCAT 0: 1
1: 0
2: 2
3: 11
4: 161
Right 1185325257 22:50222401-50222423 TCCAGACCCCCAAAGCCCAGGGG 0: 1
1: 0
2: 2
3: 19
4: 272
1185325246_1185325254 3 Left 1185325246 22:50222350-50222372 CCAGCCCTCTCCTAGAAGAGCAT 0: 1
1: 0
2: 2
3: 11
4: 161
Right 1185325254 22:50222376-50222398 GGTTTGTGTGCAGTCTCAGGGGG 0: 1
1: 0
2: 0
3: 11
4: 154
1185325246_1185325256 27 Left 1185325246 22:50222350-50222372 CCAGCCCTCTCCTAGAAGAGCAT 0: 1
1: 0
2: 2
3: 11
4: 161
Right 1185325256 22:50222400-50222422 TTCCAGACCCCCAAAGCCCAGGG 0: 1
1: 0
2: 4
3: 25
4: 283
1185325246_1185325252 1 Left 1185325246 22:50222350-50222372 CCAGCCCTCTCCTAGAAGAGCAT 0: 1
1: 0
2: 2
3: 11
4: 161
Right 1185325252 22:50222374-50222396 TAGGTTTGTGTGCAGTCTCAGGG 0: 1
1: 0
2: 1
3: 16
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185325246 Original CRISPR ATGCTCTTCTAGGAGAGGGC TGG (reversed) Intronic
900342904 1:2197147-2197169 ATGGTCCTCCAGGACAGGGCAGG - Intronic
901480013 1:9518695-9518717 TTGGTGTCCTAGGAGAGGGCTGG - Intergenic
907661568 1:56397760-56397782 ATACTCTACGAGGAGTGGGCTGG - Intergenic
909825012 1:80116807-80116829 ATGCTCTTCTGGAAGAGTGAAGG + Intergenic
910136026 1:83970989-83971011 CTGCTCTTCTGGGAGGGGGAAGG + Intronic
911255230 1:95625521-95625543 ATGCTGTACTTGGAGAAGGCTGG + Intergenic
912222722 1:107696855-107696877 ATGCTGGTGTAGGGGAGGGCAGG - Intronic
916448121 1:164892782-164892804 ATGCACTTCATGGAGGGGGCTGG + Intronic
917352190 1:174089923-174089945 ATGCACCTGTAGGAGATGGCTGG + Intergenic
919351311 1:196457795-196457817 AATCTCTTCTAGGTCAGGGCAGG - Intronic
919690613 1:200525311-200525333 ATGCTGTTCTTGGTGAGGCCTGG - Intergenic
920366739 1:205451898-205451920 TTGCTCTTAGAGGAGAGGGTAGG + Intronic
920443870 1:206001044-206001066 CTGCCCTTCTAGGATAGGGTAGG - Intronic
920793216 1:209112529-209112551 ATGTTATTATAGAAGAGGGCAGG - Intergenic
921427703 1:215023293-215023315 ATGCCTTTGTAGTAGAGGGCTGG - Intronic
921555001 1:216587624-216587646 ATGCTTTTCTAAGAGGGGGAAGG - Intronic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1069321409 10:67176123-67176145 ATCCTGTTCTAGAATAGGGCTGG + Intronic
1069345014 10:67458576-67458598 GTCCTCTTCTAGAAGAGGACAGG + Intronic
1070669040 10:78365234-78365256 AGGCTCTTCTGGGAGATGGATGG - Intergenic
1074829081 10:117236082-117236104 TTGCTCTTCTAGGAGGAGGTTGG + Intergenic
1075070064 10:119314535-119314557 ATGCTCAGCTAGGAAAGTGCGGG + Intronic
1078794533 11:14578824-14578846 AAGCTCTCCCAGGAGAAGGCCGG - Intronic
1080738203 11:35038174-35038196 ATGCTCTTCAAGGAGATAGGAGG + Intergenic
1080929466 11:36793493-36793515 ATGGGCTTACAGGAGAGGGCTGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1083714380 11:64567397-64567419 AGGCTCTTCCAGGAAAGGGCAGG - Intronic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1088237522 11:107741673-107741695 CTGCTCTTGTAGGAGTGGCCAGG + Intergenic
1089258007 11:117204203-117204225 CTCCTCTTCTAGGAAAGCGCAGG + Exonic
1092478922 12:8842605-8842627 ATGCTGATCTCGGAGGGGGCGGG + Intronic
1092821010 12:12353549-12353571 ATTCTTTTCTTGGGGAGGGCAGG - Intergenic
1094067913 12:26381045-26381067 CTGCTCTCCTAGCAGAGGGGTGG - Intronic
1094811600 12:34143426-34143448 ATGCTCCTATAGGAGATGTCTGG - Intergenic
1095148044 12:38754286-38754308 AAGATCTTCTAGTAAAGGGCTGG + Intronic
1096646333 12:53038897-53038919 ATGTTCTACCAGGAAAGGGCAGG - Intronic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1100867028 12:98868006-98868028 CTCCTCTGCTAAGAGAGGGCAGG - Intronic
1100900215 12:99231258-99231280 ATGCTTTGCTAAGAGAAGGCTGG + Intronic
1101866404 12:108523624-108523646 TTGCTCTTTTAGGAGGGGGAAGG - Exonic
1103359143 12:120343159-120343181 AAGCTCTTCTGGGAGAGAACTGG - Intronic
1103945995 12:124526730-124526752 CTGCGCTTCTCGGAGAGGACAGG + Intronic
1105723145 13:23135623-23135645 ATGCTCTTCTTGGGGAGGAGGGG + Intergenic
1106318536 13:28617000-28617022 CAGCTCTACTAGGAGGGGGCTGG + Intergenic
1107711561 13:43155187-43155209 GTGCGCTCCCAGGAGAGGGCAGG - Intergenic
1109439418 13:62349799-62349821 ATGCACATGTAGGAGATGGCTGG - Intergenic
1111764668 13:92513150-92513172 CTGTTCTTCTAGGAGAAGGGCGG + Intronic
1114189474 14:20429770-20429792 ATAAGCTTCTAGGAGTGGGCAGG - Intronic
1114912219 14:27214563-27214585 ATGCTCTTCTAAAAGAGTGAAGG + Intergenic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1118729743 14:68658071-68658093 ATGCGCTTCTTGGCAAGGGCAGG - Intronic
1119726568 14:76925047-76925069 GGGCTCTTCTCGGAGAGGCCAGG + Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1128336638 15:66790462-66790484 GTGCTCTGCTAGGTGAGGGCTGG + Intergenic
1128452289 15:67812507-67812529 ATGCTCTTCAACTAGTGGGCAGG + Intergenic
1129971460 15:79781070-79781092 ATGCACCTGTAGGAGATGGCTGG - Intergenic
1130696440 15:86136364-86136386 ATTCTGTTCTTGGAGAGGCCAGG + Intergenic
1132193907 15:99895479-99895501 AAGCTCTTCTGGGGCAGGGCAGG + Intergenic
1132598116 16:762392-762414 CTGCCCTTCTGGGAGAGGGGTGG + Intronic
1133094837 16:3436746-3436768 TGGCTCTTCTCGGAAAGGGCAGG + Exonic
1136025141 16:27464124-27464146 ATGCATTTCCAGGGGAGGGCAGG - Intronic
1137932269 16:52600377-52600399 ATGGTATTCTAGGATAGGGAAGG + Intergenic
1137979187 16:53055295-53055317 ATGCTCTGGGAGGCGAGGGCTGG - Intronic
1138231936 16:55344166-55344188 ATGCTCTTCTACAAGAAGGGAGG + Intergenic
1138338004 16:56268013-56268035 ATGCTCCCCTGGGAGAGGGGAGG - Intronic
1139200293 16:64969064-64969086 AGTCTCTTATAGGAGAGGGCAGG + Intronic
1139442868 16:66977533-66977555 ATGCCCTTGGCGGAGAGGGCTGG - Intergenic
1140231847 16:73123805-73123827 ATGCCCTTATAGAAGAGGCCTGG + Intergenic
1140485669 16:75291148-75291170 AGGCTGTTCTAGGAGAGTGTGGG + Intergenic
1144409033 17:14981990-14982012 ATGATCATCTAAGAGAGGGAAGG + Intergenic
1146271118 17:31486694-31486716 ATACTTTCCGAGGAGAGGGCTGG + Intronic
1146471942 17:33131709-33131731 ATGGTCCTCTTGGAGAGGACAGG - Intronic
1147636131 17:41965681-41965703 ATGCTCTTCCAAGAATGGGCAGG - Intergenic
1148256687 17:46139744-46139766 GTGCTGTTGTAGGAGAGGGACGG - Intronic
1148490267 17:48018972-48018994 ATCCTCTCCTAAGAGATGGCTGG - Intergenic
1149516748 17:57286835-57286857 GTGTTCTTCCAGGAGAGAGCGGG + Intronic
1149666065 17:58365381-58365403 ATGCTCTTCCAGGCCAGGGTGGG - Intronic
1152934826 17:83130184-83130206 ATGCACATCAAGGAGAGGACCGG - Intergenic
1153278280 18:3390382-3390404 ATCCTCTTCAAGGCCAGGGCTGG + Intergenic
1157199044 18:45643358-45643380 ATGTACCTCTAGGAGAGGGAGGG + Intronic
1158437275 18:57442342-57442364 TTACTGTTCTTGGAGAGGGCTGG - Intronic
1158690175 18:59653178-59653200 ATGTCCTTCTTGGAGAGGGCTGG - Intronic
1162517246 19:11155822-11155844 AACCTCTTCTGGAAGAGGGCGGG - Intergenic
1164137523 19:22427899-22427921 ACGGTCTTCTAGGAGGGGCCCGG - Intronic
1167329395 19:48845509-48845531 ATGCTCACCTAAGTGAGGGCTGG + Exonic
925171986 2:1755558-1755580 CTGCCATTCCAGGAGAGGGCCGG + Intergenic
925310947 2:2881170-2881192 CTGCTCTTCAGGCAGAGGGCAGG - Intergenic
926220776 2:10934310-10934332 ATGCTCTGCTTGGAGAGGGCAGG + Intergenic
926818491 2:16826138-16826160 ATCTTCTTCTAAGAGATGGCTGG + Intergenic
927133302 2:20079035-20079057 ATGCATTTCAAGGAGAAGGCTGG + Intergenic
931244875 2:60484143-60484165 TTGCCCTTCTAGGAGCTGGCAGG + Intronic
933328106 2:80863905-80863927 ATGCTCTTGTAGGAGTGGCCAGG + Intergenic
935238812 2:101160728-101160750 ATGCCATTCTAGGAGGGGGAGGG + Intronic
937188051 2:120064911-120064933 ATGTTCTTCTGGGAAAGGTCTGG - Intronic
937260920 2:120586484-120586506 ATGCTCTCCTAAAAGAGGTCTGG + Intergenic
937624186 2:124025194-124025216 CTGCTCTTATAGGCGAGCGCGGG + Intergenic
938898427 2:135776314-135776336 ATGCTCCTCTAGAAGAGGCAAGG + Exonic
947593502 2:231397519-231397541 GTGCTCCTTGAGGAGAGGGCAGG + Intronic
1169265919 20:4167380-4167402 AAGGTCATCTCGGAGAGGGCGGG - Intronic
1170732735 20:18988590-18988612 ATGTTCTTGTGGGAGAGAGCGGG - Intergenic
1171448619 20:25221435-25221457 AGGCTCTTCAAAGAGAGGTCAGG - Intronic
1174222160 20:48964501-48964523 AGGTTTTTCTAGGAGTGGGCTGG + Intronic
1179527653 21:41993552-41993574 CTGCAATGCTAGGAGAGGGCCGG + Exonic
1179935870 21:44602991-44603013 ATGCTGTCCTAGGACAGTGCTGG + Intronic
1181575633 22:23792792-23792814 ATGCTCTGCTAGGGGAGGAGGGG - Intronic
1181720898 22:24773537-24773559 ATGCTCTTCTCAGAAAAGGCGGG - Intronic
1182821510 22:33220802-33220824 AAGCTCTTCCAGGAGATGGTAGG - Intronic
1183097730 22:35563418-35563440 ATGATCTGCAAGGAGAAGGCTGG + Intergenic
1183453453 22:37908816-37908838 ATAGTCTTCAAGGAGATGGCAGG + Intronic
1183539801 22:38423428-38423450 TTGCTCTTTTGGGAGAGGCCTGG - Intergenic
1184232947 22:43168347-43168369 CTGCTTCTCTAGGAGAGGCCAGG + Intronic
1184241691 22:43214385-43214407 AGGCTCTTCTGGGATAGGTCAGG - Intronic
1185263771 22:49886570-49886592 ATGCTCTTCGAGGAGACGATGGG + Exonic
1185325246 22:50222350-50222372 ATGCTCTTCTAGGAGAGGGCTGG - Intronic
962293884 3:134162454-134162476 ATGCTCTGGGAGGAGGGGGCAGG + Intronic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
966592465 3:181697586-181697608 ATGGTATTGTAGGAGAGGGTAGG - Intergenic
968054433 3:195680711-195680733 AAGGTCTTCAAGGAGAGGGAGGG - Intergenic
968101457 3:195968447-195968469 AAGGTCTTCAAGGAGAGGGAGGG + Intergenic
969326224 4:6445830-6445852 ATGATGTTCTAAGGGAGGGCTGG + Intronic
975613358 4:76222572-76222594 AGGCTCCTCTAGGACAGGGCTGG - Intronic
975977582 4:80116324-80116346 ATGCTCCTGTAGGAGGTGGCTGG - Intronic
978392369 4:108240707-108240729 GTGCTCTTCTAGGATAGGAAGGG + Intergenic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
984166745 4:176311944-176311966 ATGATATTCTAGGAGTGGGTAGG - Intergenic
985441893 4:189987814-189987836 GGGCTCTTTTAGGAGATGGCTGG - Intergenic
993819942 5:92601682-92601704 ATACTCTCCTAGGAGAAGGAGGG - Intergenic
994370605 5:98963186-98963208 ATTCTCTTCTTAGAGAGGTCAGG - Intergenic
996463152 5:123770475-123770497 ATGCTCTTGTAGGAGGTGTCTGG + Intergenic
997778193 5:136630153-136630175 ATGCTGTCTTAGGAGGGGGCGGG + Intergenic
1000925100 5:167184631-167184653 ATGCTCTTCTAACACAGAGCTGG - Intergenic
1002950877 6:1810112-1810134 GAGCTCCTCTAGGGGAGGGCAGG - Intronic
1003075226 6:2977793-2977815 ATGCTATTCTAGGACCAGGCTGG + Intergenic
1003902497 6:10668128-10668150 ATGCACCTGTAGGAGATGGCTGG + Intergenic
1003931955 6:10932585-10932607 ATGCTCTGTAAGGAGAGGGGTGG + Intronic
1007735550 6:43980199-43980221 AGGCTCTTCAGGGAGAGGTCTGG - Intergenic
1008018762 6:46551772-46551794 AGGCTCTTCTAGGAGAAGGCAGG - Intronic
1011083207 6:83511849-83511871 ATTCTCCTTTAGGAGAGGGGTGG - Intergenic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1016689065 6:146914764-146914786 ATGCTCTCCTGTGAGAGGGCTGG - Intergenic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1021814867 7:24437277-24437299 ATGCTCTTCTTGGTGAGGGTAGG + Intergenic
1022275188 7:28847889-28847911 ATGCTCAGCTAGGCCAGGGCGGG - Intergenic
1027052823 7:75030570-75030592 ATGCACTTCTAAGTGAGGCCTGG + Intronic
1027053069 7:75031866-75031888 ATGCACTTCTAAGTGAGGCCTGG + Intronic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1028201278 7:87964952-87964974 ATGGTTTTCTCAGAGAGGGCTGG + Intronic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033285520 7:140037681-140037703 AGGCTCTGCTGGGCGAGGGCAGG + Intronic
1033813491 7:145045352-145045374 TTGCTCATCTAGGGGAGGACTGG - Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1035566944 8:647678-647700 AGGCTCATCCAGGAGTGGGCTGG - Intronic
1036947062 8:13104477-13104499 ATGATCATCTGGGAGATGGCAGG - Intronic
1038053229 8:23833092-23833114 TTGCTCTTCCAGGAGAATGCGGG + Intergenic
1039883223 8:41639894-41639916 ATGCTCTCCTAGGTAAGGCCAGG - Intergenic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1041989704 8:63971927-63971949 CTGCTGTTCTAGGAGAGGGAGGG - Intergenic
1043324656 8:79034641-79034663 ATGCACCTGTAGGAGATGGCTGG - Intergenic
1048859538 8:138713910-138713932 CTGCTCTTCTAAGAAGGGGCTGG + Intronic
1051744820 9:20285512-20285534 ATGCTCTTCTACTTGAGGGAGGG + Intergenic
1052896323 9:33750906-33750928 AGGCTCCTCTAGGGGAGGACGGG + Intronic
1055960338 9:81814551-81814573 ATGCTCTTCTGGGAGAAAACAGG - Intergenic
1057231263 9:93322947-93322969 TTGCTGTCCTAGGAGAGGCCTGG - Intronic
1057254067 9:93529154-93529176 AAGCTGTTCAAGGAGAGGACTGG + Intronic
1058145236 9:101403212-101403234 CTGCAGTTCTAGGAGAAGGCAGG - Intronic
1060366463 9:123020371-123020393 AAGCTCTTCGAGGAGAAGTCTGG + Exonic
1061874844 9:133538534-133538556 CTGCTCTTCAAGGAGAGCCCAGG + Intronic
1061904830 9:133691268-133691290 ATGCCCTCCTGGGAGAGGCCTGG - Intronic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1189724384 X:43954031-43954053 ATGCTCTTCTAGGGTGGGACAGG - Intronic
1191899532 X:66026504-66026526 ATGTTCTTCTCGGAGAGGAACGG + Intronic
1198446892 X:136726355-136726377 CTGCTCTTCCATGTGAGGGCTGG - Intronic
1199714657 X:150498151-150498173 ATGCTGTTCTAGGTGTGGTCTGG - Intronic
1199988594 X:152970530-152970552 AAGCTCTTCTAGGTGGGTGCTGG + Exonic
1200016113 X:153164899-153164921 ATACCCTTCCAGGACAGGGCGGG + Intergenic