ID: 1185325821

View in Genome Browser
Species Human (GRCh38)
Location 22:50225411-50225433
Sequence AGTCCTGGCTGCACTCCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 161}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185325821_1185325824 -4 Left 1185325821 22:50225411-50225433 CCATCTGGAGTGCAGCCAGGACT 0: 1
1: 0
2: 1
3: 17
4: 161
Right 1185325824 22:50225430-50225452 GACTGTCTGTCCACAGCTGGCGG 0: 1
1: 0
2: 1
3: 12
4: 180
1185325821_1185325825 -3 Left 1185325821 22:50225411-50225433 CCATCTGGAGTGCAGCCAGGACT 0: 1
1: 0
2: 1
3: 17
4: 161
Right 1185325825 22:50225431-50225453 ACTGTCTGTCCACAGCTGGCGGG 0: 1
1: 0
2: 1
3: 16
4: 170
1185325821_1185325831 16 Left 1185325821 22:50225411-50225433 CCATCTGGAGTGCAGCCAGGACT 0: 1
1: 0
2: 1
3: 17
4: 161
Right 1185325831 22:50225450-50225472 CGGGCCCGGGGAGGCCCCAACGG No data
1185325821_1185325830 7 Left 1185325821 22:50225411-50225433 CCATCTGGAGTGCAGCCAGGACT 0: 1
1: 0
2: 1
3: 17
4: 161
Right 1185325830 22:50225441-50225463 CACAGCTGGCGGGCCCGGGGAGG No data
1185325821_1185325823 -7 Left 1185325821 22:50225411-50225433 CCATCTGGAGTGCAGCCAGGACT 0: 1
1: 0
2: 1
3: 17
4: 161
Right 1185325823 22:50225427-50225449 CAGGACTGTCTGTCCACAGCTGG 0: 1
1: 0
2: 0
3: 25
4: 178
1185325821_1185325826 2 Left 1185325821 22:50225411-50225433 CCATCTGGAGTGCAGCCAGGACT 0: 1
1: 0
2: 1
3: 17
4: 161
Right 1185325826 22:50225436-50225458 CTGTCCACAGCTGGCGGGCCCGG No data
1185325821_1185325828 4 Left 1185325821 22:50225411-50225433 CCATCTGGAGTGCAGCCAGGACT 0: 1
1: 0
2: 1
3: 17
4: 161
Right 1185325828 22:50225438-50225460 GTCCACAGCTGGCGGGCCCGGGG 0: 1
1: 0
2: 0
3: 10
4: 109
1185325821_1185325827 3 Left 1185325821 22:50225411-50225433 CCATCTGGAGTGCAGCCAGGACT 0: 1
1: 0
2: 1
3: 17
4: 161
Right 1185325827 22:50225437-50225459 TGTCCACAGCTGGCGGGCCCGGG 0: 1
1: 0
2: 1
3: 26
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185325821 Original CRISPR AGTCCTGGCTGCACTCCAGA TGG (reversed) Intronic
900466132 1:2826375-2826397 AGTCCTCGCTCCACTCCACCAGG - Intergenic
901638174 1:10679981-10680003 ACTCCTGGCTGGACTCTAGGGGG + Intronic
901988013 1:13091441-13091463 TCTCCTTGCTGCACTCCTGAGGG + Intergenic
901993799 1:13135326-13135348 TCTCCTTGCTGCACTCCTGAGGG - Intergenic
902840002 1:19068538-19068560 GGGCCTGGCAGCACTCCAGGTGG - Intergenic
903055159 1:20631265-20631287 AGTCGTGGCTAAACTCCAAAAGG + Intergenic
903854932 1:26331497-26331519 AGTCCTGGGCTCTCTCCAGAAGG - Exonic
907299256 1:53476318-53476340 AGCCCTCGCTGCACACAAGATGG - Intergenic
907655709 1:56340191-56340213 ACTCCTGGCTACTCTCCAGATGG - Intergenic
907952667 1:59198664-59198686 AGTCTGGGCTCCACTCCGGAGGG - Intergenic
907974119 1:59414495-59414517 GGTTCTGGATGAACTCCAGAGGG - Intronic
910803912 1:91171613-91171635 AGTCCTCGATGGACCCCAGAAGG - Intergenic
911982828 1:104587124-104587146 AGCCCTGGCTGGAATCCAGTGGG + Intergenic
916003278 1:160636497-160636519 ATCCCTGGGTGCACTCAAGAGGG + Intronic
918112862 1:181472934-181472956 TTTCCTGCCTGCACTCCAGCAGG - Intronic
922155055 1:223034560-223034582 GGTCCTGTCTGTATTCCAGAGGG - Intergenic
922700561 1:227757328-227757350 TGTGCTGGCTGCACCCAAGATGG - Intronic
923015728 1:230125389-230125411 AGGCCTCGCTACACTCCTGAGGG - Intronic
924434896 1:244030596-244030618 AGTTCTGGCTCCATACCAGAAGG + Intergenic
924858728 1:247899636-247899658 AGTCCTGGTGGGACTCCAGGTGG + Intergenic
1063540279 10:6926605-6926627 AGTCCTGGCTTCACAGCAAAGGG + Intergenic
1063683898 10:8217502-8217524 AGTCATGGCTGCACAACCGAAGG + Intergenic
1064018133 10:11788345-11788367 AGTCCTGGCAGCCCTGCATAGGG + Intergenic
1068338211 10:55665953-55665975 AATACTGGCTGAATTCCAGATGG - Intergenic
1070702527 10:78613983-78614005 TGGCCTGGCTGCACTCCTGATGG + Intergenic
1070855993 10:79608425-79608447 GGTTCTGGATACACTCCAGAGGG + Intergenic
1071282566 10:84115850-84115872 AGTCCTGGTGGTACTCCAGGTGG - Intergenic
1073452486 10:103618084-103618106 AGAGCAGGCTGCCCTCCAGAGGG - Intronic
1075027973 10:119000908-119000930 GCTCCTGGCTGCCCTCCAGGAGG + Intergenic
1075376562 10:121982556-121982578 AGCCCTGGCTGGACTACACATGG - Intergenic
1075653407 10:124145151-124145173 AGTTCCGGCTGCACTGCTGATGG - Intergenic
1076662128 10:132062771-132062793 AGTCCTGGCAGGATTCCAGGAGG + Intergenic
1077116586 11:887871-887893 AGAGCTGGCTTCACTCCACAAGG + Intronic
1078168561 11:8911289-8911311 AGTCCTGGCTGGGCTCCCGCTGG + Intronic
1078280213 11:9893682-9893704 AGTCTTGCCAGCACTCCAGCAGG + Intronic
1078918158 11:15800332-15800354 TCTGCTGGCTGCATTCCAGAGGG + Intergenic
1079991770 11:27253794-27253816 AGTGCTGTCTGCTCTCAAGATGG - Intergenic
1081441789 11:43089027-43089049 AGCCCTGGCTGTTCTCCAGTGGG - Intergenic
1084859223 11:72007278-72007300 AGTCCAGGCTGCTCTCCAGGGGG + Exonic
1085409149 11:76281398-76281420 TGTCCTGGCTGGGCTCCAGGCGG + Intergenic
1085876086 11:80406922-80406944 AATTCAGGCTGCATTCCAGAAGG - Intergenic
1087068175 11:94047094-94047116 AATCTTGGCTGCACTCCAGGTGG - Intronic
1087684856 11:101250973-101250995 AGTCCTGGTGGGACTCCAGGTGG - Intergenic
1096217820 12:49808284-49808306 AGTCCTAGCCCCACTCCAGCTGG - Intronic
1097791834 12:63823310-63823332 AGTCCTCGCTGGACTGCTGAGGG + Intergenic
1100270249 12:93017776-93017798 GGTCCTGCCTACACTCAAGAGGG + Intergenic
1105843031 13:24272145-24272167 CGTGCTGGCTGCACTCCCGGTGG - Intronic
1112124416 13:96448684-96448706 TGTCTAGGCTGAACTCCAGAGGG + Intronic
1118966937 14:70595682-70595704 AGTCCTGGCTGTCTTCCAGCAGG - Intronic
1119660924 14:76451055-76451077 AGCCCTCCCTGCCCTCCAGAAGG - Intronic
1120663765 14:87281109-87281131 ATTCTTGGCTTCACTTCAGAAGG - Intergenic
1121502327 14:94448168-94448190 TGTCCTGGCTGAACTCCGGGAGG + Exonic
1121634584 14:95445237-95445259 GGTCCTGGCTGTACCCCATATGG + Intronic
1122088672 14:99323761-99323783 ACTCATGGCTGCACCCAAGAGGG + Intergenic
1122810937 14:104287561-104287583 ATGCCAGGCTGCGCTCCAGAGGG + Intergenic
1122836646 14:104433956-104433978 CGTCCTTCCTGCCCTCCAGAGGG + Intergenic
1123888858 15:24755395-24755417 AGTCCTTGCCACACTACAGAAGG + Intergenic
1123998305 15:25733992-25734014 AGGCCTGGCTGCACTCCCCCCGG - Intronic
1127375471 15:58380741-58380763 AGCCTTGGCTCCACTCCAGCTGG + Intronic
1127993443 15:64137326-64137348 AGTCTTGGCTCCACCCCAGAGGG - Intronic
1129805190 15:78450509-78450531 ATCCCTGCCTGCACTCCAGAGGG - Intronic
1129824524 15:78625897-78625919 AGACCTGGCTGGCCTCCAGAGGG + Intronic
1133467663 16:6043308-6043330 AGTCCTGGCTGCATTCATGGAGG + Intronic
1134115371 16:11543920-11543942 AGTCCTTGCAGGACTCCAGGAGG + Intergenic
1137041382 16:35615939-35615961 AGTCCTGGTGGGACTCCAGGTGG + Intergenic
1137609328 16:49808599-49808621 AGCCCTTGCTGAACTCCAGTGGG - Intronic
1142298333 16:89241377-89241399 AGCCCCGGCTGCCCTTCAGACGG - Intergenic
1146660068 17:34659731-34659753 AGTCCTGGAAGAAGTCCAGAGGG + Intergenic
1147874907 17:43614246-43614268 ACTCCTGCCAGCACTCCAGTGGG + Intergenic
1149371684 17:56000764-56000786 AATCCAGGGTTCACTCCAGACGG - Intergenic
1151353911 17:73547214-73547236 AGACCTGCCTGCCCTGCAGAGGG - Intronic
1152287425 17:79421134-79421156 CGTCCTGGCTTCACAGCAGAGGG + Intronic
1152535095 17:80946015-80946037 AGTCCTGCCTGCAGGTCAGAGGG + Intronic
1154999493 18:21672973-21672995 ATTCCTGCCAGCGCTCCAGATGG + Intronic
1155922428 18:31616709-31616731 ATACCTGTCTGCTCTCCAGAGGG + Intergenic
1156458448 18:37307748-37307770 AGACCTGGCTGCCCTCAAGGAGG + Intronic
1157525235 18:48375407-48375429 AGTCCTGACTTCAGTCTAGAGGG - Intronic
1157695768 18:49722272-49722294 ACTCTAGGCTGCACTCCAGAGGG + Intergenic
1160919409 19:1512858-1512880 AGTCCGGGCTGCAGCCCACACGG - Intronic
1161439787 19:4284471-4284493 AGTCTGGGCTGAACCCCAGAAGG + Intronic
1161493094 19:4573169-4573191 CGGCCTCGCTGCACTCCAGCTGG + Intergenic
1161811194 19:6472239-6472261 GGTCCAAGCTGGACTCCAGAGGG - Intronic
1161846946 19:6717122-6717144 AGTCCTCCCTGCAGTCCACAAGG - Intronic
1162770227 19:12944883-12944905 AGTCCTGGAGGCATCCCAGAGGG - Intergenic
1163109633 19:15151767-15151789 AGTCCTCGCTGAACTCCAGCTGG - Intergenic
1164574516 19:29397909-29397931 TGCCCTGGGTGCTCTCCAGATGG - Intergenic
1165211004 19:34235768-34235790 AGTTCTGGCTTCTCTCCCGAAGG - Intergenic
1166894544 19:46015572-46015594 AATCCTGTCTGGACTCCAGACGG - Intronic
1168095172 19:54110289-54110311 AGTCCTGAGTGCCCTCCAGTGGG + Intronic
925924371 2:8659755-8659777 AGCCCTGGCAGCTCTGCAGATGG - Intergenic
930338025 2:50075308-50075330 CATCTTGGCTGCACACCAGATGG + Intronic
932416155 2:71575026-71575048 AGTCCTGGCTGGATTTCAGAGGG - Intronic
934697387 2:96409982-96410004 AGTCCTGCCTGCACTCCTCCCGG + Intergenic
937201855 2:120209173-120209195 AGGCCTGGCTGCCCTCCTGAGGG + Intergenic
938137959 2:128774777-128774799 CACCTTGGCTGCACTCCAGAAGG - Intergenic
938211539 2:129469627-129469649 AATCCTGGCATCACTGCAGAAGG + Intergenic
939172184 2:138709165-138709187 GGTGCTGGCTCCACTCGAGACGG + Intronic
943374152 2:187054660-187054682 AGTTCAGGCTGCAGTCCAGTAGG + Intergenic
945801330 2:214434995-214435017 AGTCTTTGCTGCATTTCAGAAGG + Intronic
947913276 2:233816499-233816521 AGCCCACCCTGCACTCCAGATGG - Intronic
948447449 2:238043792-238043814 GTTCTTGGCTGGACTCCAGAGGG + Intronic
1168926236 20:1581856-1581878 AGCCATGGCAGCACTCCAAAAGG - Intronic
1168930104 20:1614910-1614932 AGCCATGGCAGCACTCCAAAAGG - Intronic
1168934506 20:1651779-1651801 AGTCTTGGCAGCACTCCAAAAGG - Intronic
1168939989 20:1701195-1701217 AGTCTTGGCAGAACTCCAAAAGG - Intergenic
1170819385 20:19743439-19743461 AGTCCTGCCCGCACTGAAGAGGG - Intergenic
1172226551 20:33309230-33309252 AGTTTTGGCTCCACTCTAGAGGG - Intronic
1173353580 20:42266418-42266440 AGGCCTGGCTGAACTGCAGGAGG + Intronic
1175532414 20:59683013-59683035 AGTCATTGCTGCAATCCAGGCGG + Intronic
1175773583 20:61638979-61639001 AGCCTTGGCTGCCCTCCACATGG - Intronic
1178448054 21:32663426-32663448 AGTCCTGGTGGGACTCCGGATGG - Intronic
1179384669 21:40930807-40930829 AGTCCATGCTGCACTGCACAAGG + Intergenic
1181310681 22:21943100-21943122 ACTCCTGGATGGCCTCCAGAAGG + Intronic
1181541092 22:23573743-23573765 AGGGCTGTCTGCTCTCCAGAGGG - Intronic
1181797290 22:25319587-25319609 AGGGCTGTCTGCTCTCCAGAGGG + Intergenic
1184785639 22:46670403-46670425 AGTCCTGGGTGCTAGCCAGAGGG - Intronic
1185023855 22:48396501-48396523 AGTTCAGGGTGCATTCCAGAAGG + Intergenic
1185159646 22:49215512-49215534 AGTCCTGACTGGACTCAGGAGGG - Intergenic
1185206666 22:49542917-49542939 AGCCCTGGCTGCTCTGCAGAAGG + Intronic
1185325821 22:50225411-50225433 AGTCCTGGCTGCACTCCAGATGG - Intronic
949887748 3:8709869-8709891 ATTTCTGGCTGAAATCCAGATGG - Intronic
950614536 3:14148382-14148404 AATTCTGGCTTCCCTCCAGAGGG - Intronic
953660963 3:44891208-44891230 AGCACTGGCTTCTCTCCAGAGGG + Intronic
955542720 3:59994904-59994926 AGCCCTGTCTGCACAACAGATGG + Intronic
958568694 3:95851257-95851279 AGTTCTGGCTGAACTCAAAAAGG - Intergenic
961212583 3:125137276-125137298 AGTCCTGACTGGACTCCCAAGGG - Intronic
963511083 3:146250668-146250690 GGTCCTGGCTGCACTTCACGGGG - Intronic
964924355 3:161937773-161937795 AGTCCTGGTGGGACTCCAGGTGG - Intergenic
968688472 4:1977077-1977099 TGGCCTGGCTGCACTACAGTGGG + Intronic
969906923 4:10405788-10405810 CCTACTGGCTGCATTCCAGATGG - Intergenic
970201764 4:13616695-13616717 AATCCATCCTGCACTCCAGATGG - Intronic
978207507 4:106095576-106095598 AGTGCTGCCTTCACTGCAGAAGG - Exonic
978739833 4:112123996-112124018 AGCTCTGGCTGCACTCTGGAGGG - Intergenic
979974438 4:127179282-127179304 AGTCCTGAATGCAATCCAAATGG + Intergenic
980352194 4:131698014-131698036 TGCCCTGGCTGCCCTCCAGCTGG - Intergenic
980985789 4:139692836-139692858 AGTCCAAACTGCACTGCAGAGGG - Intronic
982068590 4:151675460-151675482 ACTCCTGGCTGGAGTCCAGGAGG + Intronic
985631225 5:1015081-1015103 ACACCTGGCTGCTCTCCAGGTGG - Intronic
986608725 5:9546452-9546474 AGACGTGGCTGCACCCCGGAGGG + Intergenic
996746511 5:126850981-126851003 AGTTCTGGCTGGAGTCTAGACGG - Intergenic
1001705643 5:173739398-173739420 AGTGCTGGCGGCACCCCAGCAGG - Intergenic
1003163374 6:3655087-3655109 TGTCCTGCCTGCACTCGGGAAGG - Intergenic
1003445938 6:6184432-6184454 AGTTCTGGCTGCTCTGCTGAGGG - Intronic
1003962517 6:11221887-11221909 AATGCTGGCTGAAATCCAGATGG - Intronic
1006844600 6:37053621-37053643 AGTGCTGCCTGCATTTCAGATGG + Intergenic
1006947046 6:37791593-37791615 AGTCCTGGCAGCACTGCAACTGG + Intergenic
1009995823 6:70894147-70894169 AGGCCTGTCTGCTCTCCAGCCGG + Exonic
1014121343 6:117728770-117728792 GGACCTGGCTGCACTTTAGAAGG - Intergenic
1015849871 6:137560556-137560578 ACTGCTGGCTGCCCTCCTGAAGG + Intergenic
1017034198 6:150252321-150252343 GGGCCTGGCTGCACTGCAGATGG - Intergenic
1022445065 7:30463535-30463557 AGTCCTGGTTGCTCTCCAGGAGG - Intronic
1023111142 7:36811875-36811897 ACTCCTGGGGGCAGTCCAGAAGG + Intergenic
1024261680 7:47578267-47578289 AGTCCAGGCTGGAGTCCAGTCGG - Intronic
1024544471 7:50505771-50505793 GGTCCTGGCTGGACTCTGGAAGG + Intronic
1031470974 7:122169052-122169074 ACTCCTGCCTGGACTACAGAGGG - Intergenic
1034352985 7:150429260-150429282 AAGCCTGGCTGCACTGGAGAAGG - Intergenic
1035287898 7:157817695-157817717 AGCCCTGGCTGCCCTGCAGAGGG + Intronic
1035556385 8:570193-570215 AGTCGTGGCTGCACTCCACAGGG - Intergenic
1038013138 8:23490653-23490675 AGTCATGGCTGGAGTCCAGGTGG + Intergenic
1044845659 8:96378179-96378201 AGTCCTTACAGCACTACAGAAGG - Intergenic
1045756844 8:105553661-105553683 AGTGCTGGGGGCACTGCAGATGG - Intronic
1047206243 8:122804788-122804810 AGTCCCGGCTGGGCTACAGATGG - Intronic
1049322061 8:142001854-142001876 AGCTGTGGCTGCACCCCAGAAGG + Intergenic
1049332688 8:142063610-142063632 AGTCCTGGCTGTGCTCCCTAGGG + Intergenic
1053609291 9:39694900-39694922 AGTCCTGGTTGGTCTCCAAAAGG - Intergenic
1053867130 9:42451172-42451194 AGTCCTGGTTGGTCTCCAAAAGG - Intergenic
1054089024 9:60776588-60776610 AGTCCTGGTTGGTCTCCAAAAGG + Intergenic
1054244233 9:62647497-62647519 AGTCCTGGTTGGTCTCCAAAAGG + Intergenic
1054558359 9:66682045-66682067 AGTCCTGGTTGGTCTCCAAAAGG + Intergenic
1055287529 9:74745255-74745277 AGTCCTGGCTTCACTGCTTAAGG + Intronic
1056500959 9:87208873-87208895 ATGCCTGACTGCACTTCAGAGGG - Intergenic
1062135786 9:134927205-134927227 AGTCCAGGCAGGACTCCAGTTGG + Intergenic
1062417072 9:136456787-136456809 AGTCCTGGCTGTACTGCTGCAGG - Intronic
1193359106 X:80560071-80560093 AGTCCTGGGAGCACAGCAGAAGG + Intergenic
1199698598 X:150361192-150361214 AGTCCTGTCTGCTCTGCAAAGGG - Intergenic
1200972915 Y:9175852-9175874 AATCCTGGCAGGACTCCAAATGG - Intergenic
1202160153 Y:21925432-21925454 AGTCCAGGCTGGACAACAGAGGG + Intergenic
1202231202 Y:22660950-22660972 AGTCCAGGCTGGACAACAGAGGG - Intergenic
1202311956 Y:23535215-23535237 AGTCCAGGCTGGACAACAGAGGG + Intergenic
1202558846 Y:26135379-26135401 AGTCCAGGCTGGACAACAGAGGG - Intergenic