ID: 1185325822

View in Genome Browser
Species Human (GRCh38)
Location 22:50225426-50225448
Sequence CAGCTGTGGACAGACAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 224}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185325822_1185325831 1 Left 1185325822 22:50225426-50225448 CCAGGACTGTCTGTCCACAGCTG 0: 1
1: 0
2: 1
3: 25
4: 224
Right 1185325831 22:50225450-50225472 CGGGCCCGGGGAGGCCCCAACGG No data
1185325822_1185325837 26 Left 1185325822 22:50225426-50225448 CCAGGACTGTCTGTCCACAGCTG 0: 1
1: 0
2: 1
3: 25
4: 224
Right 1185325837 22:50225475-50225497 TTTCCCACGCCAGCAAAGCCTGG 0: 1
1: 0
2: 2
3: 11
4: 152
1185325822_1185325838 27 Left 1185325822 22:50225426-50225448 CCAGGACTGTCTGTCCACAGCTG 0: 1
1: 0
2: 1
3: 25
4: 224
Right 1185325838 22:50225476-50225498 TTCCCACGCCAGCAAAGCCTGGG 0: 1
1: 0
2: 1
3: 14
4: 143
1185325822_1185325830 -8 Left 1185325822 22:50225426-50225448 CCAGGACTGTCTGTCCACAGCTG 0: 1
1: 0
2: 1
3: 25
4: 224
Right 1185325830 22:50225441-50225463 CACAGCTGGCGGGCCCGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185325822 Original CRISPR CAGCTGTGGACAGACAGTCC TGG (reversed) Intronic
900169400 1:1258955-1258977 CAGGTGTGGCCAGGGAGTCCTGG - Intronic
900399389 1:2466824-2466846 CAGCACTGGACAGACAGGGCAGG + Intronic
900647183 1:3714299-3714321 AAGCTGTGGCCAGAGACTCCGGG + Intronic
901629852 1:10642770-10642792 CAGCTTGGGACAGAAGGTCCGGG - Intronic
901926253 1:12568002-12568024 CATCTGGGGACAGACCCTCCTGG + Exonic
902791645 1:18772807-18772829 GAGCTGAGGTCAGACAGTCATGG - Intergenic
902975174 1:20083253-20083275 CAGCTGTGGACAGAACCTTCAGG + Intronic
904497231 1:30893764-30893786 CAGCTGGGGTCAGAGAGGCCAGG - Intronic
905120631 1:35679249-35679271 CATCTGTGGAGAGGCAGACCAGG - Intergenic
905144470 1:35877005-35877027 CAGCTTTGGACAGGCTGCCCTGG - Intronic
905171658 1:36113441-36113463 CAGGTGTGGACTGTCAGTGCTGG - Intronic
906274859 1:44507969-44507991 GGGCTCGGGACAGACAGTCCTGG + Intronic
910712817 1:90199435-90199457 CTACTGTTGACAGACATTCCTGG + Intergenic
911052883 1:93686632-93686654 CAGCAGGGGTCAGACAGACCTGG - Intronic
913170843 1:116230887-116230909 CACGTGTGGCCAGAGAGTCCAGG - Intergenic
916689979 1:167180852-167180874 CAGCTGTGGACAGGGAGGCAAGG + Intergenic
917443098 1:175084024-175084046 CAAGTGTGCACAGACAGCCCAGG + Intronic
917793064 1:178512236-178512258 CATCTGAGGACAGACAGCACAGG - Intergenic
921011715 1:211148332-211148354 CAGCTATAGCCAGAGAGTCCAGG + Intergenic
922470732 1:225875637-225875659 CCGCTGTGGACAGAGAGGGCAGG - Intronic
922920573 1:229299303-229299325 CAGCTGTGGAAAGGTAGTCAAGG + Intronic
923352747 1:233125567-233125589 CAGGGGTGGGCAGGCAGTCCAGG + Intronic
1063095216 10:2903142-2903164 CAGCTCTGCACTGACAGCCCAGG + Intergenic
1064113105 10:12555296-12555318 CAGAAGAGGACAGACTGTCCTGG - Intronic
1066987260 10:42478858-42478880 CAGATGTGCACACACAGACCTGG + Intergenic
1068581632 10:58747081-58747103 CAGCCATGGAAAGACAGACCTGG - Intronic
1069820616 10:71225395-71225417 CAGCTGTGGCCAGCCAGGCATGG - Intronic
1070351694 10:75598908-75598930 CACCTTTGGACAGAGTGTCCAGG + Intronic
1073845438 10:107548534-107548556 CAGCTATAGACAGGCAGTCCTGG - Intergenic
1075405169 10:122190492-122190514 CAGGTGGGGACAGACTGTGCTGG - Intronic
1076289632 10:129335039-129335061 CAGCTGGGGACAGAGAGCTCGGG + Intergenic
1076324196 10:129608756-129608778 GAGATGTGGAGTGACAGTCCAGG + Intronic
1078392047 11:10943839-10943861 CAGCTGAAGACATACTGTCCAGG + Intergenic
1081975955 11:47234968-47234990 CAGCAGTGGTCAGACAGGCAGGG - Intronic
1083813750 11:65120229-65120251 CAGCTGTGGCCTTAGAGTCCAGG - Intergenic
1084044557 11:66561244-66561266 CAGCTGTGACCAGACACTGCAGG + Exonic
1085720279 11:78906354-78906376 TAGCCATGGACAGACATTCCAGG - Intronic
1086667972 11:89508329-89508351 GACCTGTGGCCAGACAGCCCAGG + Intergenic
1087723407 11:101692335-101692357 CCTCTGTGGACAGACAGCCTGGG - Intronic
1089870884 11:121671787-121671809 CAGCTTTGTTCAGACTGTCCTGG - Intergenic
1091668455 12:2435903-2435925 GAGCAGTGGACAGACTGGCCAGG + Intronic
1091848517 12:3676829-3676851 CAGGTGTGGACAGACAGACCTGG - Intronic
1091929510 12:4383551-4383573 CAGCTGTGAACAGGAAGCCCAGG + Intergenic
1092106526 12:5925471-5925493 CAGCTCTGGAGAGGCACTCCAGG + Intronic
1092823282 12:12373699-12373721 CTGATGTGGTCAGACAGTGCAGG + Intronic
1096071985 12:48780554-48780576 AAGCTGTAGCCAGACACTCCTGG + Intronic
1097021711 12:56025534-56025556 CAGCTGGGGAGAGGCAGTCATGG - Intronic
1100604646 12:96141732-96141754 CAGCTCCGGACAGACAGAACTGG + Intergenic
1101895847 12:108755986-108756008 GTGCTGTGGACAGATAGTCCTGG - Intergenic
1102060379 12:109926733-109926755 CAGCAGGAGGCAGACAGTCCTGG + Intronic
1104178078 12:126351900-126351922 CAGCTGAGGTCACACAGGCCTGG - Intergenic
1105986955 13:25576778-25576800 CAGATGTGGACTGTCAGTGCTGG + Intronic
1107448211 13:40486656-40486678 CCTCTGGGGACAGACTGTCCAGG + Intergenic
1107958971 13:45542557-45542579 CTGCTGTGGGCAGAGAGACCAGG - Intronic
1113523323 13:110955469-110955491 AAGCTCTGGACAGAGAGTCTCGG + Intergenic
1113701983 13:112395027-112395049 AAGCTCTGGACAGAGAGTCTCGG - Intronic
1113830441 13:113291383-113291405 GAGCTGTGGACAGACCCTCAAGG + Intergenic
1118755911 14:68843601-68843623 CAGCTGTGACAAGACAGGCCTGG - Intergenic
1119473913 14:74916163-74916185 CAGCTGTGCCCAGACAGATCTGG - Intronic
1122898020 14:104769951-104769973 TAGCTGGTGACAGACAGCCCAGG + Exonic
1122960323 14:105091172-105091194 CAGCTGAGGACAAACTCTCCTGG + Intergenic
1125191879 15:37003036-37003058 CAGCTGTGGTCAGTCATTCAAGG - Intronic
1125401109 15:39304197-39304219 CAGCTGTGAAGAGTGAGTCCAGG + Intergenic
1127444890 15:59050966-59050988 TAGCTGTGGAGAGACAGAGCAGG + Intronic
1127581806 15:60345669-60345691 CACCAGTGGCCAGACTGTCCTGG + Intergenic
1128248419 15:66148680-66148702 CAGATGTGGAGAGACTGCCCAGG - Intronic
1128819356 15:70638087-70638109 CATCTGGGCACAGACAGTGCAGG - Intergenic
1129068846 15:72934241-72934263 AAGCTGTGGCCAGCCAGTTCTGG - Intergenic
1129898631 15:79128518-79128540 TATCTGTGGACAGACAGAACTGG + Intergenic
1130525680 15:84704313-84704335 CAGCAGTGGACAAGCAGTCATGG + Intronic
1132021122 15:98363586-98363608 CAGCAGTGGCCAGACAGTGATGG + Intergenic
1132386896 15:101407160-101407182 CAGCTGGGGTCAGAGAGTCCTGG + Intronic
1132731835 16:1366639-1366661 CGGCAGTGGCCAGACAGGCCAGG + Intronic
1132734880 16:1380374-1380396 CACCTGGGGCCAGACAGTCCCGG + Intronic
1132780970 16:1625264-1625286 CAGCTGTGGACCGAGAACCCTGG - Intronic
1132860694 16:2070292-2070314 CTGCTGTGGAGAGAGAGTCCTGG + Intronic
1132877868 16:2148410-2148432 CAGCTGTGGGGTGACAGGCCTGG - Intronic
1134174839 16:11997286-11997308 CAGCTATGGAAAGACAGGGCAGG - Intronic
1137613559 16:49834670-49834692 CCTCCGTGGACAGACAGTTCTGG - Intronic
1138342816 16:56301965-56301987 GAGGTGTGGGCAGAAAGTCCTGG + Intronic
1140273302 16:73485363-73485385 CAGCTGTTTAGATACAGTCCAGG + Intergenic
1140406674 16:74716177-74716199 CAGCTGTGCAGAGACAGGCAAGG - Intronic
1142306578 16:89289395-89289417 ACACTGTGGACAGACAGTCCTGG + Intronic
1143508553 17:7383113-7383135 AGGCTGTGGACAGAGAGACCAGG - Intronic
1143633129 17:8150106-8150128 CAGCAGTGAACAGTCAGCCCGGG - Exonic
1147024691 17:37570717-37570739 CAGCCTTGGACAGCCAGTCATGG - Exonic
1147042981 17:37732112-37732134 AAGCCGGGGACAGGCAGTCCAGG + Intronic
1148135548 17:45289462-45289484 AAGCTGGGGAGAGACAGTGCGGG - Intronic
1148544225 17:48504562-48504584 GAGCTGGGGACAGACAAGCCTGG + Intergenic
1148742875 17:49902554-49902576 GAGCACTGGACAGAGAGTCCAGG + Intergenic
1148792773 17:50183085-50183107 CAGCGGGGGACAGAGAATCCAGG - Intergenic
1151313496 17:73308626-73308648 CACCTGCGCACAGACAGTCCGGG + Intronic
1151766312 17:76135195-76135217 CAGCTTTGGACTGACAGGCTGGG - Intergenic
1152161467 17:78671084-78671106 CAGCTGTGGACAGGCTGAGCTGG + Intergenic
1152750159 17:82058921-82058943 CAGCTGTGGCCAGCCAGGCCAGG + Intronic
1152780894 17:82227066-82227088 CAGCTCTGGGTGGACAGTCCTGG + Intergenic
1153275139 18:3360682-3360704 CAGCTGTAGATCGGCAGTCCCGG - Intergenic
1153625650 18:7020217-7020239 GAGGTGTGGACAGGCCGTCCAGG - Intronic
1153692689 18:7609250-7609272 CAGCTATGCAAAGACAGACCAGG - Intronic
1153928444 18:9856352-9856374 AAGGTGTGGACAGACCTTCCTGG + Intronic
1154409068 18:14126072-14126094 CAGCTGTGGAGAGGCAGTAGGGG + Intronic
1157524582 18:48371260-48371282 CAGCTGGGGACAGAAACACCAGG - Intronic
1159338424 18:67101301-67101323 CTGCTGTGGACAGATTTTCCAGG - Intergenic
1159489790 18:69116926-69116948 CAGTTATGGATAGACAGACCAGG + Intergenic
1160055061 18:75471286-75471308 CATCTGTGGATAGACAGCCCTGG + Intergenic
1160243203 18:77137414-77137436 AAGCTGTGCCCAGACAGCCCAGG + Intergenic
1160697891 19:493481-493503 CAGCTGTGGACAGGGAGGCCAGG + Intronic
1161005248 19:1932520-1932542 CAGATGAGCACAGACACTCCTGG + Intergenic
1161296853 19:3524470-3524492 AGGCTGTGGAGAGACAGCCCTGG + Intronic
1161303966 19:3556936-3556958 AGGCCGTGGACAGACAGTGCAGG + Intronic
1163819554 19:19488185-19488207 CAGCGGTGGTCAGACATTCACGG + Intronic
1164587252 19:29483781-29483803 CAGCTGAGGTCAGATAGACCTGG - Intergenic
1164981823 19:32619886-32619908 TGCCTGTGGACAGACAGGCCTGG - Intronic
925395404 2:3529893-3529915 CAGCAGTGGACTGACAGGGCTGG - Intergenic
925822666 2:7815626-7815648 CAGATGTGCACACACAGTACAGG - Intergenic
925957135 2:8977943-8977965 CAGCCGTGGAGACAGAGTCCGGG - Intronic
926094641 2:10073225-10073247 CGGCTGTGGGCTGCCAGTCCAGG + Intronic
927089136 2:19697315-19697337 CAGTTGTGGTCAGACAGAACTGG + Intergenic
927219955 2:20697494-20697516 CAGCTATGAACAGCCAGTTCAGG - Intronic
933817523 2:86080136-86080158 CAGCCTTGGGTAGACAGTCCGGG - Intronic
933949967 2:87320497-87320519 CTGCTGAGAACAGACAGACCTGG - Intergenic
936330224 2:111541100-111541122 CTGCTGAGAACAGACAGACCTGG + Intergenic
937100652 2:119265389-119265411 CAGCAGTGGACGCACAGTCAGGG - Exonic
937992308 2:127671497-127671519 CCGCTGTGGATAGAAAGCCCGGG + Intronic
938990584 2:136624370-136624392 CAGCTGTGGCCAGTCAGTAGTGG + Intergenic
939041065 2:137190032-137190054 CATTTGTGGAAAGCCAGTCCAGG + Intronic
943394718 2:187319929-187319951 CAGCTATGGCCAGTAAGTCCAGG - Intergenic
945013796 2:205493036-205493058 CAGCTGAAGACAGATAGTCATGG - Intronic
946224980 2:218259639-218259661 CAGCTCTGCACAGCCAGTCAGGG - Intronic
947476612 2:230454848-230454870 CAGCAGTGGACAGATTGTCCAGG - Intronic
948060770 2:235042065-235042087 CAGCTGTGGGGACACGGTCCAGG + Exonic
948252612 2:236542615-236542637 CAGATGGGGACATACAGCCCAGG - Intergenic
1169226818 20:3862083-3862105 CACCTGTGGACAGAGGGTCTGGG + Intronic
1170573988 20:17648936-17648958 CGGCTGTGGTCAGACAGCCTGGG - Intronic
1170984211 20:21243131-21243153 CAGCAGCTGACTGACAGTCCTGG - Intronic
1171505512 20:25629875-25629897 CAGCTGTCCCCAGACTGTCCAGG - Intergenic
1172468853 20:35176148-35176170 GAACTGTGGATAGACAGTCAGGG - Exonic
1172634606 20:36401478-36401500 CAGGTGAGGACACACAGCCCGGG - Intronic
1172657852 20:36547978-36548000 CAGCTGGGGACAGAGGGCCCAGG + Intronic
1173619930 20:44429204-44429226 CCGCTGGGGACAGCCAGGCCTGG + Intronic
1174079556 20:47961228-47961250 GAGCTGTGAACAGACAGACCTGG - Intergenic
1175050552 20:56151676-56151698 CTGCTGTGGGAAGTCAGTCCTGG + Intergenic
1175241328 20:57551628-57551650 CATCTCTAGACAGACAGTCACGG - Intergenic
1175313445 20:58027977-58027999 CAGCTTTGAACAAACACTCCAGG + Intergenic
1175552539 20:59826672-59826694 CTGCTCTGCACACACAGTCCTGG + Intronic
1175846284 20:62060609-62060631 GAGCTGTGTAAAGACAGCCCTGG - Intronic
1175985689 20:62763203-62763225 TAGCAGTGGACAGATAGGCCCGG + Intergenic
1176244653 20:64091623-64091645 CAGCCTTGGACAGACTGGCCCGG - Intronic
1176864146 21:14033815-14033837 CAGCTGTGGAGAGGCAGTAGGGG - Intergenic
1176885767 21:14254005-14254027 GTGCTCTGGACAGACAGTCTAGG - Intergenic
1177945613 21:27465887-27465909 GAGCAGTGCACAGACAGTGCAGG - Intergenic
1179044541 21:37832649-37832671 GACCTGAGGACAGACAGACCAGG - Intronic
1179260208 21:39751107-39751129 CAGATGTGGCCTCACAGTCCAGG - Intronic
1179419668 21:41225327-41225349 CAGCTATGGACACACTGTACAGG - Intronic
1180626746 22:17198898-17198920 CTGCTGTGGACGGACTATCCTGG - Intronic
1183663980 22:39236896-39236918 ACGGTCTGGACAGACAGTCCTGG + Intronic
1184238714 22:43200359-43200381 AAGCTGGGGGCAGAGAGTCCAGG - Exonic
1184667254 22:45995522-45995544 AAGCTGAGGAGAAACAGTCCCGG - Intergenic
1185109530 22:48893388-48893410 CAGGTGTGGACAGAGAGACCCGG + Intergenic
1185109535 22:48893408-48893430 CGGGTGTGGACAGAGAGACCCGG + Intergenic
1185173830 22:49307958-49307980 CAGGTGTGCACAGCCAGGCCCGG - Intergenic
1185193568 22:49453936-49453958 CAGCTGCTGACTGACAGTCCTGG - Intronic
1185325822 22:50225426-50225448 CAGCTGTGGACAGACAGTCCTGG - Intronic
953018233 3:39098169-39098191 CAGATGTGGGCAGGCAGCCCGGG - Exonic
953693865 3:45142591-45142613 CACCTGTGGAGAGCCTGTCCTGG - Intronic
953847865 3:46443228-46443250 GAGCTGAGGTCAGACAGCCCTGG + Intronic
954124086 3:48518514-48518536 CAGCTGTAAACAGACTGCCCAGG + Exonic
955210494 3:56935987-56936009 CATCTGTGGCCAGAGAGTCAAGG - Intronic
955364004 3:58296543-58296565 CCGCTGTGGGCAGACCCTCCTGG + Intergenic
956123796 3:65992538-65992560 AAGCTTTGGTTAGACAGTCCTGG - Intronic
959400731 3:105898846-105898868 GATCTGTGGACAGAAAGTCCTGG + Intergenic
960108878 3:113826261-113826283 GAGTTGTGGACAGACAGAACAGG - Intergenic
961351565 3:126307780-126307802 CAGCTGGGGACGCACAGCCCAGG - Intergenic
961392177 3:126558663-126558685 CAGGTGTGATCAGAGAGTCCTGG + Exonic
961561400 3:127732904-127732926 CAGCTCTGCTCAGACAGCCCTGG - Intronic
962682232 3:137812358-137812380 CAGCAGTGGACGGACTTTCCAGG - Intergenic
962927945 3:140012390-140012412 AAGCTCTGGACAGCCTGTCCTGG - Intronic
963997386 3:151725503-151725525 CAGCTGTGGAGGGAGAGACCTGG - Intergenic
966183065 3:177204239-177204261 GCGCTGTGCACAGACAGCCCCGG + Intergenic
967016730 3:185488963-185488985 GAGCTGGGGACTGACAGTACAGG - Exonic
967350649 3:188510660-188510682 CAGCTGTGGTCAGACAATGCAGG - Intronic
967636145 3:191805016-191805038 CACCTGTAGACAGATACTCCAGG + Intergenic
967812526 3:193772748-193772770 CAGATGTGTCCAGACAGTCTAGG - Intergenic
968035506 3:195544396-195544418 CAGCAGTGGACAGACATTGCTGG - Intergenic
969183533 4:5459437-5459459 CAGCTGTTAAATGACAGTCCCGG + Intronic
969469037 4:7375772-7375794 CCTCTGTGGACACACAGTGCCGG - Intronic
970492083 4:16584957-16584979 CAGCTGAGGACACACAGTGTGGG + Intronic
971043343 4:22778781-22778803 CAGGTGTGGACCGGCAGTGCTGG + Intergenic
971421614 4:26478344-26478366 CAGCTGTGGACAGAAAGAGAGGG + Intergenic
974060443 4:57029000-57029022 AAGCCCTGGACAAACAGTCCAGG - Intronic
974666424 4:64968761-64968783 CAGGTGTGGACAGAGAGAACTGG - Intergenic
977399425 4:96512798-96512820 CAGCAGTGGACAGATCTTCCAGG + Intergenic
983265540 4:165504305-165504327 CAGCTGAGGACAGGGACTCCTGG + Intergenic
984404310 4:179307488-179307510 CAGCTGGAGACAGACAGTGGAGG + Intergenic
986372971 5:7099041-7099063 GAGCTGGGGACAGACATTGCAGG + Intergenic
992618758 5:78571742-78571764 GAGCTGTGGACAGGCAGTGCTGG - Intronic
996670967 5:126116887-126116909 CAACTGTGGACACACAGTAGGGG + Intergenic
999391853 5:151199082-151199104 CACCTGGGGGCAGAGAGTCCCGG + Exonic
1000193230 5:158933598-158933620 CAGCTGAGAACAGAGAGACCAGG + Intronic
1001215981 5:169856121-169856143 CAGATGTTGACAGAGAGACCTGG - Intronic
1001308914 5:170596646-170596668 CATCTGTGAACAGACACTGCTGG + Intronic
1001421112 5:171587943-171587965 CAGCTGTTGACAGAGAGTGTGGG + Intergenic
1002181556 5:177433516-177433538 CACCTGTGGCCAGACAGACAGGG - Exonic
1006443989 6:34068730-34068752 CTGCTGTGGGGAGACAGTCAGGG + Intronic
1006947045 6:37791578-37791600 CATCTGTGCACAGGCAGTCCTGG + Intergenic
1010070854 6:71743602-71743624 CATTTGTGGAAAGACAGTCTAGG - Intergenic
1011704343 6:89985936-89985958 CAGCTGTGGGAAGACAGTGTGGG + Intronic
1013413270 6:109901285-109901307 CAACTCTGGACAGACAGTGGTGG - Intergenic
1014514754 6:122365341-122365363 CAGCTGTGGACAGCTTGCCCTGG + Intergenic
1015919811 6:138255551-138255573 CGGCCGTGGTCAGACACTCCCGG - Exonic
1016726715 6:147379084-147379106 CAGCTGTGGGCAGACAGATGTGG - Intronic
1018635566 6:165856235-165856257 CAGCTGTGTACAGAAATACCTGG - Intronic
1018716490 6:166536682-166536704 CAGCTCTGGACAGGCATTACTGG + Intronic
1018967590 6:168500646-168500668 CAGCTCTGGCCAGACACTGCTGG + Intronic
1019354847 7:573066-573088 CAGCTGTGGACCGCACGTCCAGG - Intronic
1019523082 7:1469247-1469269 CAGCTGTGGACAGGCACGCCTGG + Intergenic
1019800385 7:3084129-3084151 AAGCTGAGCACAGACAGGCCAGG + Intergenic
1021421092 7:20445297-20445319 GAGCTGTGGAAGGGCAGTCCAGG + Intergenic
1021718777 7:23486165-23486187 CAGCTGTGGAAACAAAGGCCCGG - Intergenic
1025200904 7:56961067-56961089 CAGCCGTGTTCAGACAGCCCAGG - Intergenic
1025671039 7:63615865-63615887 CAGCCGTGTTCAGACAGCCCAGG + Intergenic
1026374388 7:69735785-69735807 CTGCTGTAGACAGCCAGTGCAGG + Intronic
1029135427 7:98367100-98367122 CAGCTGTGGACAGACCAGCCTGG - Intronic
1029323661 7:99787271-99787293 CATCAGTGGACAGGCTGTCCAGG + Intergenic
1029466210 7:100726554-100726576 CAGGAGTGGTCAGACAGTTCAGG - Intergenic
1030328447 7:108247074-108247096 CAGCTGGGGCCAGAGAGTCCAGG - Intronic
1031939194 7:127769311-127769333 GACCTGTGGACAGACAGCCCAGG - Intronic
1032478409 7:132227602-132227624 CAGCTGTGAACAGCCAGGCGGGG + Exonic
1033907675 7:146225615-146225637 TAGCAGTGCACAGACAGTCATGG + Intronic
1034711814 7:153199168-153199190 CAGCGGGGGACAGGCAGCCCTGG + Intergenic
1035110995 7:156481484-156481506 CTGCTGAGGACAGACCCTCCAGG - Intergenic
1035464314 7:159064769-159064791 CAGCTGTGCACAGGCGGCCCCGG - Intronic
1039475396 8:37836957-37836979 CACCTGTGCACAGACAGTTACGG + Intronic
1043343756 8:79274112-79274134 CAGCTGTGGCCAGAGAGACCAGG + Intergenic
1044418206 8:91960388-91960410 CATCTGTGGACAGACCCTGCAGG - Exonic
1044954454 8:97465151-97465173 CAGCTGGGGACAGAGCTTCCTGG + Intergenic
1048472549 8:134716449-134716471 CAGGTGTGCACAGGCAGACCGGG - Intergenic
1049006304 8:139857746-139857768 CAGCTGTTGGCAGGCAGCCCAGG - Intronic
1049341072 8:142112966-142112988 CAGCTGTGAAAAGCCAGTCAAGG - Intergenic
1049553246 8:143270327-143270349 CAGATGGGGACAGAGAGTCCGGG + Intronic
1052831869 9:33222247-33222269 CAGATGTGGGCAGACTGTGCTGG - Intronic
1053456376 9:38236057-38236079 AAGCTGTGGACAGTCACCCCTGG - Intergenic
1056797188 9:89666692-89666714 CAGGTTTGGCCACACAGTCCAGG + Intergenic
1057562894 9:96141881-96141903 CAGCTGTGAACAGTCACTTCTGG - Intergenic
1059146462 9:111904081-111904103 CAACTGTGGGCAGACAGCCTGGG - Intronic
1059434071 9:114266012-114266034 CAGGTGTGGGGGGACAGTCCAGG + Intronic
1060031320 9:120217216-120217238 AAGGTGTGGACAGAGTGTCCTGG - Intergenic
1062590892 9:137274168-137274190 CAGCTGTGGCCTCACACTCCAGG - Intergenic
1196720832 X:118852293-118852315 CATCTGTGGGTTGACAGTCCTGG + Intergenic
1197820879 X:130539516-130539538 CACCTGTGGACATACAACCCAGG - Intergenic
1200032759 X:153309725-153309747 CAGCCGTGCTCAGACAGTGCAGG + Intergenic