ID: 1185325830

View in Genome Browser
Species Human (GRCh38)
Location 22:50225441-50225463
Sequence CACAGCTGGCGGGCCCGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185325822_1185325830 -8 Left 1185325822 22:50225426-50225448 CCAGGACTGTCTGTCCACAGCTG 0: 1
1: 0
2: 1
3: 25
4: 224
Right 1185325830 22:50225441-50225463 CACAGCTGGCGGGCCCGGGGAGG No data
1185325821_1185325830 7 Left 1185325821 22:50225411-50225433 CCATCTGGAGTGCAGCCAGGACT 0: 1
1: 0
2: 1
3: 17
4: 161
Right 1185325830 22:50225441-50225463 CACAGCTGGCGGGCCCGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185325830 Original CRISPR CACAGCTGGCGGGCCCGGGG AGG Intronic
No off target data available for this crispr