ID: 1185325881

View in Genome Browser
Species Human (GRCh38)
Location 22:50225648-50225670
Sequence CACCCACCCAGGCCACCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 304}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185325874_1185325881 0 Left 1185325874 22:50225625-50225647 CCTTCATCTCAACTCCCCCTTGG 0: 1
1: 0
2: 1
3: 24
4: 172
Right 1185325881 22:50225648-50225670 CACCCACCCAGGCCACCGCCAGG 0: 1
1: 0
2: 4
3: 46
4: 304
1185325869_1185325881 15 Left 1185325869 22:50225610-50225632 CCCGTTGACACCCACCCTTCATC 0: 1
1: 0
2: 2
3: 11
4: 138
Right 1185325881 22:50225648-50225670 CACCCACCCAGGCCACCGCCAGG 0: 1
1: 0
2: 4
3: 46
4: 304
1185325868_1185325881 16 Left 1185325868 22:50225609-50225631 CCCCGTTGACACCCACCCTTCAT 0: 1
1: 0
2: 2
3: 9
4: 103
Right 1185325881 22:50225648-50225670 CACCCACCCAGGCCACCGCCAGG 0: 1
1: 0
2: 4
3: 46
4: 304
1185325871_1185325881 5 Left 1185325871 22:50225620-50225642 CCCACCCTTCATCTCAACTCCCC 0: 2
1: 0
2: 5
3: 68
4: 631
Right 1185325881 22:50225648-50225670 CACCCACCCAGGCCACCGCCAGG 0: 1
1: 0
2: 4
3: 46
4: 304
1185325870_1185325881 14 Left 1185325870 22:50225611-50225633 CCGTTGACACCCACCCTTCATCT 0: 1
1: 1
2: 2
3: 34
4: 289
Right 1185325881 22:50225648-50225670 CACCCACCCAGGCCACCGCCAGG 0: 1
1: 0
2: 4
3: 46
4: 304
1185325873_1185325881 1 Left 1185325873 22:50225624-50225646 CCCTTCATCTCAACTCCCCCTTG 0: 1
1: 1
2: 1
3: 20
4: 193
Right 1185325881 22:50225648-50225670 CACCCACCCAGGCCACCGCCAGG 0: 1
1: 0
2: 4
3: 46
4: 304
1185325867_1185325881 30 Left 1185325867 22:50225595-50225617 CCTTCATCTCAACTCCCCGTTGA 0: 1
1: 0
2: 1
3: 6
4: 99
Right 1185325881 22:50225648-50225670 CACCCACCCAGGCCACCGCCAGG 0: 1
1: 0
2: 4
3: 46
4: 304
1185325872_1185325881 4 Left 1185325872 22:50225621-50225643 CCACCCTTCATCTCAACTCCCCC 0: 1
1: 1
2: 3
3: 50
4: 600
Right 1185325881 22:50225648-50225670 CACCCACCCAGGCCACCGCCAGG 0: 1
1: 0
2: 4
3: 46
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185325881 Original CRISPR CACCCACCCAGGCCACCGCC AGG Intronic
900102904 1:970420-970442 CACCCAGCCCGGCCCCCACCTGG - Exonic
900173244 1:1280879-1280901 CACCCACCCAGGCCAGCAGCCGG + Intronic
900295989 1:1950030-1950052 CACCCACCAAGGCCACTCCTAGG - Intronic
900429392 1:2594694-2594716 CACGCATCCAGTCCCCCGCCTGG + Intronic
901649967 1:10737728-10737750 CACTCACCAAGGCCAGGGCCTGG + Intronic
903224777 1:21888329-21888351 CACACATGCAGGCCACAGCCTGG + Intronic
903737922 1:25542153-25542175 CACACATCCAAGCCACAGCCTGG - Intergenic
904744695 1:32703283-32703305 CAGCCACCCAGCCCGCCCCCAGG - Intronic
904942754 1:34176857-34176879 CCCCCACCCACCCCACCGGCGGG + Intronic
905848346 1:41253868-41253890 CACCCTCCCAGGACAGAGCCAGG - Intergenic
906154036 1:43603673-43603695 CACCCACCCAAGGAACTGCCTGG + Exonic
906521420 1:46469129-46469151 CACACACCCAGGGAACCTCCAGG + Intergenic
906580397 1:46930820-46930842 CACCCACCCAGTTCTCCTCCAGG - Intronic
906581175 1:46936262-46936284 CACCCACCCAGGCTCTGGCCTGG - Intronic
906602550 1:47142614-47142636 CACCCACCCAGGCTCTGGCCTGG + Intronic
906603326 1:47148068-47148090 CACCCACCCAGTTCTCCTCCAGG + Intronic
909020070 1:70420610-70420632 CCCCAACCCAGGCCACAGACAGG - Intronic
912666278 1:111582879-111582901 CTCCCACCTAGGCCAGAGCCTGG + Intronic
913611564 1:120514229-120514251 GAGCCACCCAGCCCACCACCTGG - Intergenic
914579628 1:149008010-149008032 GAGCCACCCAGCCCACCACCTGG + Intronic
915348181 1:155208690-155208712 CCCCCACCCAAGCCCCAGCCCGG + Exonic
918070615 1:181131291-181131313 CAACCCCTCAGGCCACTGCCAGG - Intergenic
920224677 1:204429914-204429936 CACCCACCTCGGCCACCTCAGGG + Exonic
920440215 1:205975824-205975846 CACCCACCCAGGCCCAGCCCAGG + Intergenic
922109964 1:222547233-222547255 CTCCAACCCCTGCCACCGCCAGG + Intronic
922570989 1:226634640-226634662 CGCCCTCCCTGGCCCCCGCCTGG - Exonic
924539967 1:244970964-244970986 TCCTCACCCAGGCCACCCCCCGG - Exonic
924707549 1:246511832-246511854 CACCCAGCCAGACCTCCCCCTGG + Intergenic
1063605896 10:7522625-7522647 CCACCGCCCAGGGCACCGCCTGG + Intergenic
1067809660 10:49417374-49417396 CTCCCCCACAGGCCACCCCCAGG + Intergenic
1068958101 10:62839131-62839153 CTGCCACCCAGGCCACAGACTGG + Intronic
1069862635 10:71481117-71481139 CTGCCACCCAGGCCACAGCTGGG - Intronic
1071363844 10:84878605-84878627 GACCCACCCAGGCCACAGTCAGG - Intergenic
1072164816 10:92802847-92802869 CACCCACCCAGGTCACCTAGGGG - Intergenic
1073452977 10:103620304-103620326 CACCCACCCGGCTGACCGCCTGG - Intronic
1074867717 10:117554459-117554481 CTGGCAGCCAGGCCACCGCCAGG - Intergenic
1074923714 10:118046487-118046509 CACCCCCGCAGCCCTCCGCCCGG - Exonic
1075581972 10:123625685-123625707 CACCCAGCCAGGCCAACATCTGG + Intergenic
1076441591 10:130484475-130484497 CACCTCCCCAGGCCACTTCCTGG - Intergenic
1076482727 10:130795495-130795517 CATCCTCCCAGGCCACTCCCTGG + Intergenic
1076576864 10:131475215-131475237 CCCCCACCCAGGCCTGCCCCGGG + Intergenic
1076655659 10:132021884-132021906 TTCCCACCAAGGCCAGCGCCCGG - Intergenic
1076692244 10:132229835-132229857 GATCCACCCAGGCCACCGCTTGG - Intronic
1076864378 10:133159974-133159996 CCCCCACCCCGGGCCCCGCCCGG + Intergenic
1077130766 11:971344-971366 CGCACGCCCAGGCCACTGCCAGG - Intronic
1077352670 11:2100106-2100128 CCCCCACCCAGGCCAGCCTCAGG - Intergenic
1077394948 11:2316120-2316142 CGCCCACCTAGGCCAATGCCAGG - Intronic
1077415382 11:2422219-2422241 CACCCACCAGGGACACCACCAGG + Exonic
1077490370 11:2858270-2858292 CCCACCCCCCGGCCACCGCCTGG + Intergenic
1077556294 11:3227747-3227769 CACCCACCAAGGCCTCCTCCAGG + Exonic
1077819262 11:5719892-5719914 CAACCAACAAGGCCACCACCAGG - Intronic
1081567958 11:44271156-44271178 TACCCCCCCAGGGCACTGCCAGG + Intronic
1081713373 11:45232295-45232317 CAACCCCTCAGGCCACCTCCTGG - Intronic
1083675080 11:64320714-64320736 CACTCAGACAGGCCACCACCTGG - Exonic
1084045272 11:66564513-66564535 CATCCAGCCAGGCCACAGGCAGG - Intronic
1084122421 11:67077467-67077489 CACCCACTCCGGCCACACCCAGG + Intergenic
1084194459 11:67516552-67516574 CACCTCCCCAGGCCTCAGCCTGG - Intergenic
1084195857 11:67523355-67523377 GGCCCACCCGGGCCACCCCCGGG - Exonic
1084604683 11:70165610-70165632 CACCCACACACCCCTCCGCCTGG - Intronic
1085313701 11:75531008-75531030 CACCCACTTGGGCCACAGCCGGG - Intergenic
1085515972 11:77112227-77112249 CACCCATCCAGCCCACCCCAAGG - Intronic
1086398618 11:86442618-86442640 CACCCACCCAGGCCAGTTCTGGG - Intronic
1086431680 11:86742506-86742528 AACCCACCCAGCACACCTCCTGG + Intergenic
1086612865 11:88778173-88778195 CCCCCAGCCAGGCTACAGCCTGG + Intronic
1091323714 11:134668930-134668952 CCCCTACCCAGGCCAGCCCCAGG - Intergenic
1092126093 12:6075873-6075895 CAGCCACCCAGGCCAACTCCAGG - Intronic
1092240526 12:6833544-6833566 CACCCACCAAGGTCAGCCCCTGG - Intronic
1092959789 12:13585274-13585296 CACTCACCCTGGCCTCCGCCTGG - Intronic
1094470091 12:30795455-30795477 CAACCCCCCAGACCACCACCCGG - Intergenic
1095926134 12:47581437-47581459 CACCCACAGAGGCCACTTCCAGG + Intergenic
1099973683 12:89525310-89525332 CGCCCAGCCAAGCCGCCGCCTGG - Intronic
1101446213 12:104738501-104738523 CACACACCCAGGCAAGGGCCTGG + Intronic
1102042881 12:109811856-109811878 CACACACACAGGCCACCGAGAGG + Intronic
1102776286 12:115522513-115522535 CACCCACCCAGGCAGGGGCCAGG + Intergenic
1103004309 12:117409073-117409095 CAGCCAGCCAGGCTACAGCCTGG + Intronic
1103908125 12:124337706-124337728 CGCCCACCCTGGCCGCCCCCTGG - Intronic
1104284288 12:127410306-127410328 CACTCACTCATGCCACGGCCTGG - Intergenic
1104990747 12:132622564-132622586 CAGCCAGCCAGGCCACGGTCAGG + Intergenic
1106457763 13:29942400-29942422 CACCCACCCAGGCATGTGCCTGG + Intergenic
1106735787 13:32586770-32586792 CCCCGCCCCGGGCCACCGCCAGG - Intronic
1108701486 13:52947956-52947978 CAGCCACCCAGCTCAGCGCCTGG - Intergenic
1110177377 13:72573365-72573387 CACCCACCCAGGCCTCCCAAAGG + Intergenic
1112197005 13:97236005-97236027 CACCCTCCCCAGCCTCCGCCAGG - Intronic
1113643710 13:111976687-111976709 CACCCACCCAGGCCGCGCCCTGG - Intergenic
1115758521 14:36554229-36554251 CATCCACCCAGGATACCACCTGG - Intergenic
1116164913 14:41323137-41323159 CACCACCACAGGCCACCCCCTGG - Intergenic
1119185873 14:72642188-72642210 CACCCACCCAAGCCATTCCCAGG + Intronic
1119620916 14:76131312-76131334 CTCCCGCCCAGCCCACCGACGGG - Intergenic
1121127505 14:91417624-91417646 CACTCACCCAGGTCACCAGCGGG + Exonic
1121235159 14:92386794-92386816 CAGCAGCCCAGGCCACAGCCGGG - Intronic
1121259517 14:92555940-92555962 CACTCACCCCAGCCACCACCCGG - Exonic
1122156938 14:99755596-99755618 CACACAGCCAGTCCACAGCCGGG - Intronic
1122306761 14:100771321-100771343 CACCCAGCCAGCCCCCAGCCTGG - Intergenic
1122353118 14:101108933-101108955 CACCCACCCAGGGCGCCCCTAGG + Intergenic
1122409532 14:101518764-101518786 CACCAACCCAGCCTACAGCCTGG - Intergenic
1122601645 14:102924485-102924507 CACCCACCCAGGCCCCTCGCTGG - Intronic
1122704194 14:103609799-103609821 CTCCCACCCAGGCCTCCTCCTGG + Intronic
1122848039 14:104511342-104511364 CACACACGCAGCCCACAGCCGGG + Intronic
1122863512 14:104593283-104593305 CACCCACCCAGTCCACTGCCAGG + Exonic
1122919276 14:104873410-104873432 ACCCCACCCAGGCCACAGTCAGG - Intronic
1123019596 14:105391511-105391533 CTCCCACCCTGCCCACCCCCAGG + Intronic
1123028278 14:105438802-105438824 CACCCACACTGGCCACCCACAGG - Intronic
1123704296 15:22939956-22939978 CACCTCCCCAGGCCACCTCAGGG + Intronic
1123797139 15:23783417-23783439 CACCCTCCCAGAGCACCACCTGG - Intergenic
1125508447 15:40280686-40280708 CCCCTACCCAGGCCAACTCCGGG - Intronic
1125520410 15:40345117-40345139 CACCCTCCCAGGCCACCCGCTGG + Intergenic
1125664182 15:41417200-41417222 CTCCCACGCCGGCCGCCGCCCGG - Exonic
1127381970 15:58438299-58438321 CAACCACCCAGGCCTCAGCCTGG + Intronic
1129194821 15:73957514-73957536 CACCTCCCCAGGGCACTGCCAGG + Intergenic
1131115158 15:89790880-89790902 TACCCGCACAGGCCACCCCCCGG + Intronic
1131116229 15:89797759-89797781 CACCCAGCCCAGCCACAGCCTGG + Intronic
1133219894 16:4315604-4315626 CGCCCCCCCAGGCCACCTCCCGG + Intronic
1136003215 16:27311934-27311956 CACACTCCCACGCCACCTCCAGG + Intergenic
1136570667 16:31094697-31094719 CACCCAGCCAGGGCTCCCCCAGG + Exonic
1138476243 16:57272081-57272103 TACCCTGCCAGGCCCCCGCCAGG + Intronic
1139434148 16:66926488-66926510 CAGCCACCCAGGGCACATCCAGG + Intergenic
1141132161 16:81444402-81444424 CACCCACCCCCGCCGCCCCCGGG - Intergenic
1141330267 16:83104613-83104635 CGCCCACCCCCGCCACCGCCTGG - Intronic
1141560024 16:84861809-84861831 AAGCCTCCCAGGCCACAGCCAGG - Intronic
1141663218 16:85452855-85452877 CACTCACCTAGCCCAGCGCCTGG - Intergenic
1142157102 16:88537612-88537634 CCCCCCACCAGACCACCGCCTGG + Intergenic
1142234433 16:88915184-88915206 CCCACACCCACGCCACCACCTGG - Intronic
1142597936 17:1038652-1038674 CACGCCCCCAGGCCACGGCAAGG + Intronic
1143420046 17:6781649-6781671 CACCCAGCCAGTCCACTGCAGGG + Intronic
1145274284 17:21420700-21420722 CACCAAACCAAGCCACCTCCAGG - Intergenic
1145312144 17:21706599-21706621 CACCAAACCAAGCCACCTCCAGG - Intergenic
1145939945 17:28738010-28738032 CACCCATCCAGGCCACCCCCTGG - Intronic
1146057644 17:29589276-29589298 CGCACAGCCAGGCCGCCGCCGGG - Intronic
1146442323 17:32907932-32907954 CACCTACCCAGGCTTCCCCCAGG - Intergenic
1148241271 17:46000819-46000841 GACCCAGCCAGGCCAGCCCCTGG + Intronic
1148331327 17:46815541-46815563 CCCCAACCCAGCCCCCCGCCTGG - Intronic
1149038543 17:52159683-52159705 CACCCACCCAGGCCGAGGCCAGG + Intronic
1149346900 17:55748029-55748051 CACCCACCCATCCCATCCCCTGG + Intergenic
1151368417 17:73631627-73631649 CATCCACCCAGTCCCCCACCAGG - Intronic
1151719615 17:75847733-75847755 CACCTACCCAGGCTCCCCCCAGG - Intronic
1152040441 17:77899358-77899380 CCCCAACCCAGGGCACCTCCAGG + Intergenic
1152110917 17:78357422-78357444 CACCAAGCCAGCCCACAGCCAGG - Exonic
1152235226 17:79135166-79135188 CACCTGCCCAGTCCACTGCCCGG + Intronic
1152246397 17:79186885-79186907 CACCCTCCAAGGCCCCTGCCAGG - Intronic
1152640572 17:81447626-81447648 CACCCACCCAGGGCGCTACCAGG + Exonic
1152664279 17:81558329-81558351 CTCCCACCCAGGCCATCGCAGGG + Exonic
1152945036 17:83193561-83193583 CACCCACCCAGGCCAGGGCCAGG - Intergenic
1156171816 18:34494321-34494343 CTCCCACCCAGGCATCGGCCCGG - Intronic
1158976757 18:62716596-62716618 CACCCGCCCGGGCCGCCGACGGG - Exonic
1160527743 18:79547459-79547481 GCCCCACGCAGGCCACAGCCGGG + Intergenic
1160777215 19:861809-861831 CAACCACGCGGGCCGCCGCCCGG + Exonic
1160810800 19:1012218-1012240 GCCCCGCCCAGGCCACCCCCTGG + Intronic
1160832601 19:1110709-1110731 CACCCACCCACACCACACCCCGG + Intronic
1160894417 19:1395945-1395967 AACCAGCCCATGCCACCGCCTGG - Intergenic
1161014117 19:1975029-1975051 CACCCACCCAGCACACACCCAGG + Intronic
1161242188 19:3228626-3228648 CCCCCACCCGGGCCCCCGCCGGG - Intronic
1161285118 19:3464593-3464615 CCCCGACCCAGGCCAAAGCCAGG + Intronic
1161392409 19:4028352-4028374 CCCCCACTCAGGCCACACCCGGG + Intronic
1161487106 19:4542538-4542560 CCCCCACCCGTGCCACCCCCAGG + Intergenic
1161592815 19:5136453-5136475 CCCCCAGGCAGGCCACCGCCAGG - Intronic
1161715021 19:5871006-5871028 CTCCCACACAGGCCACAGCGTGG + Intronic
1163168160 19:15511766-15511788 CACGGACCCAGGCCGACGCCAGG - Intronic
1163677574 19:18662992-18663014 CACCCTCCCAGGCAAACACCAGG + Intronic
1163714347 19:18865396-18865418 ATGCCACCCATGCCACCGCCTGG + Exonic
1163726912 19:18928254-18928276 CGTCCACCCAGGACACCGTCTGG + Exonic
1163779862 19:19240463-19240485 CCCCCACCCAGCCCACCTCCAGG + Intronic
1165012638 19:32859834-32859856 CACTCACCACAGCCACCGCCTGG + Exonic
1165421782 19:35725634-35725656 CACCCACCCTGGCCAGCCCTTGG - Intronic
1165459501 19:35936440-35936462 CGCCCAGCCCGGCCCCCGCCCGG + Intronic
1166396442 19:42444679-42444701 TCCACACCCAGGCCACCGCAGGG + Intergenic
1166748322 19:45152462-45152484 GCACCACCCACGCCACCGCCTGG + Exonic
1167277929 19:48550120-48550142 CACCCCACCAGGCCTCCGGCTGG - Intergenic
1167613286 19:50517514-50517536 CCCCCACCCAGGTCCCAGCCCGG - Exonic
925462297 2:4074021-4074043 CAACCCCCCAGGCCACTGTCTGG + Intergenic
925463986 2:4089699-4089721 CACCCACCCAGGCACCTCCCTGG + Intergenic
925973716 2:9126077-9126099 CAGCCACCCAGGCTACGGCTGGG - Intergenic
926101647 2:10122240-10122262 CTCCCAGCCGGGCCGCCGCCGGG - Intergenic
926162372 2:10498032-10498054 CACCCACCCAGACAACGCCCCGG - Intergenic
926794166 2:16605386-16605408 CTCCGGCCCAGGCCACCGCTGGG + Intronic
927757274 2:25719124-25719146 CACCCACCCAGGCTTACACCTGG + Intergenic
928093888 2:28392608-28392630 CTCCCGCCCGTGCCACCGCCTGG + Intronic
930003412 2:46877311-46877333 CACCCAGCCAGGTCCCCGCGCGG + Intergenic
933974480 2:87497289-87497311 CACCCACCCAGGCTGCCCCCAGG + Intergenic
934119809 2:88828259-88828281 CTCCCACCCAGACCCCCGCATGG - Intergenic
935327336 2:101948860-101948882 CACCCACCCTGCCCATCCCCTGG + Intergenic
935904868 2:107829279-107829301 GAGCCATCCAGGCCGCCGCCGGG - Intronic
936163282 2:110100797-110100819 CTCCCACCCAGACCCCCGCATGG - Intronic
936319344 2:111453530-111453552 CACCCACCCAGGCTGCCCCCAGG - Intergenic
936427324 2:112432938-112432960 GACCCATCGAGGCCGCCGCCGGG + Intronic
936427378 2:112433116-112433138 GACCCATCGAGGCCGCCGCCGGG + Intronic
936427404 2:112433206-112433228 GACCCATCGAGGCCGCCGCCGGG + Intronic
936427431 2:112433296-112433318 GACCCATCGAGGCCGCCGCCGGG + Intronic
937230630 2:120396265-120396287 CACCCAGCCCGCCCTCCGCCAGG - Intergenic
937492594 2:122385577-122385599 CTCCCACCCAGGCCCCTCCCTGG - Intergenic
937987183 2:127643113-127643135 CACACAGCCTGGCCACCTCCAGG + Intronic
944263075 2:197696436-197696458 CCCCCACCCAGCCAGCCGCCCGG - Intronic
947615822 2:231556335-231556357 CACCCACCCTGGCCTCAGCACGG + Intergenic
948401214 2:237686911-237686933 CACACACCCAGGTCAATGCCAGG - Intronic
1169073380 20:2747405-2747427 CACCCTCCCAGCCAACTGCCAGG + Intronic
1170756898 20:19212810-19212832 CGCCCGCCGAGGCCGCCGCCCGG + Exonic
1172393857 20:34585121-34585143 CACCATGCCTGGCCACCGCCTGG + Intronic
1172520040 20:35560360-35560382 CACCCACCCCGGCCCCAGCTGGG - Intergenic
1173576302 20:44114927-44114949 CCCCCACCCAGGTCACAGCAAGG + Intronic
1173684257 20:44911606-44911628 CACCCACTCAGGCAACCACCAGG - Intronic
1173687267 20:44932382-44932404 CACCCACCCAGCCTGCCCCCAGG + Exonic
1175470223 20:59222283-59222305 CACCCACCCCGCCGCCCGCCCGG - Intronic
1175870655 20:62208070-62208092 CACCCAGCCGGGCCACGGCCAGG - Intergenic
1175963219 20:62647519-62647541 TACCCACCCAGCCCAGCTCCAGG + Intronic
1176013777 20:62917100-62917122 CCCCCACCCACACCACCGCCAGG + Intronic
1176122183 20:63458870-63458892 GACCCACACAGGCCCCCTCCCGG - Intronic
1176141302 20:63546283-63546305 CACCCGCCCATGCAACCCCCAGG + Intronic
1176270783 20:64234799-64234821 CACCCACCATGGCCAGCCCCGGG - Intronic
1176270935 20:64235274-64235296 CACCCACCATGGCCAGCCCCGGG - Intronic
1176271032 20:64235581-64235603 CACCCACCATGGCCAGCCCCGGG - Intronic
1176271269 20:64236277-64236299 CACCCACCGCGGCCAGCCCCGGG - Intronic
1176427739 21:6559135-6559157 CACACACCCAGGACACTCCCGGG - Intergenic
1177148357 21:17430269-17430291 CACCCAAGCAGGCCACAGCCTGG + Intergenic
1177569140 21:22863674-22863696 CACCCACCTCGGCCTCCGCTGGG - Intergenic
1179023218 21:37657788-37657810 GACCCGCCCAGGCCACCCTCTGG + Intronic
1179173833 21:38992789-38992811 CACCCCCACAGGCCACAGGCTGG - Intergenic
1179703231 21:43167452-43167474 CACACACCCAGGACACTCCCGGG - Intergenic
1179939577 21:44628921-44628943 CACCCACCCAGCCCAGCACAGGG - Intronic
1180070152 21:45431858-45431880 CACCCACCCACTCACCCGCCTGG - Intronic
1180086930 21:45511922-45511944 CACCCAGCCAGGCCAAGCCCTGG + Intronic
1181172096 22:21015557-21015579 CCCCCACCCAGGCCCCACCCAGG + Intronic
1181277358 22:21695231-21695253 CACCCACAGAGGCCCCGGCCAGG - Intronic
1181486801 22:23236679-23236701 CCCACACCCAGGCCAACGTCAGG - Intronic
1181633691 22:24164571-24164593 CAGCCACCCTGGACACAGCCTGG + Intronic
1182237955 22:28891286-28891308 CACTCAGCCAGGCTACAGCCGGG - Intronic
1182305581 22:29365670-29365692 CTCCCACCCAAGCCACCACCTGG + Intronic
1182312855 22:29421608-29421630 CTCCCACCCAAGCCACCACCTGG + Intronic
1182468310 22:30531870-30531892 CACCCACCCATGCCCCTGGCGGG + Intronic
1183132599 22:35853730-35853752 CACCACCCCATTCCACCGCCTGG - Intronic
1183301267 22:37060298-37060320 CACCCACCCCCACCACTGCCAGG + Intronic
1183338354 22:37264085-37264107 CTGCCACCGAGGCCACAGCCAGG + Intergenic
1183479871 22:38057596-38057618 CACCTACCCAGCCCCCCACCCGG + Intronic
1183648867 22:39142348-39142370 ACCCCACCCAGGCCACAGCCAGG + Intronic
1183893650 22:40950950-40950972 CGCCCACCCACGCCAGCACCGGG + Intergenic
1184276418 22:43411792-43411814 CACCCGCCGGGGCCCCCGCCAGG - Intronic
1184778013 22:46632967-46632989 GACCCACACAGCCCCCCGCCCGG + Intronic
1184783577 22:46660997-46661019 CACCAAGCCAGGCCACAGGCTGG - Intronic
1185223089 22:49638983-49639005 CACCAGCCCAGGCCACAGGCCGG + Intronic
1185325881 22:50225648-50225670 CACCCACCCAGGCCACCGCCAGG + Intronic
950020471 3:9783981-9784003 CAGCCTCCAAGGCCACCCCCGGG + Intronic
950045601 3:9947075-9947097 CAGCCACCGCGGCCAACGCCAGG + Exonic
950572060 3:13807376-13807398 CACCTCCCCGGGCCACCACCTGG + Intergenic
954162417 3:48732339-48732361 CACCCACCCAGGCTGCAGGCTGG - Intronic
954449750 3:50565459-50565481 CTCTCACCAAGGCCACAGCCAGG + Exonic
954639213 3:52088189-52088211 CACCCAACAAGGCCACCTCCGGG + Intronic
955053105 3:55431311-55431333 GACCAACCCTGGCCACAGCCTGG - Intergenic
961545502 3:127629987-127630009 CACCCACACAGCCCGCCGCCCGG - Intronic
961547520 3:127645569-127645591 CTCCCACCCAGCCCATGGCCTGG - Intronic
967944957 3:194797197-194797219 CACCCACACAAGCCACCTACAGG - Intergenic
968516904 4:1019267-1019289 CTCCCACCCAGGACAGGGCCAGG + Intronic
968905712 4:3449709-3449731 CCCCCTCCCAGGCCAGCCCCAGG + Intergenic
969053154 4:4386750-4386772 CTCGCGCCCAGGCCGCCGCCCGG + Exonic
969057462 4:4410678-4410700 CACCCACCCAGACCAGCTTCCGG - Intronic
969327140 4:6450613-6450635 CACCCACCCAGGCAGCTGCCTGG + Intronic
969425598 4:7122142-7122164 CCCCACCACAGGCCACCGCCTGG + Intergenic
970407518 4:15778176-15778198 GACCCACCCACTCCACCTCCAGG - Intergenic
970695055 4:18667329-18667351 GACCAACCCAGCCCACCGTCAGG - Intergenic
978885259 4:113761076-113761098 CTCCCAGCCAGGGCACAGCCCGG - Intronic
981348036 4:143698845-143698867 CTCCCACTCAGGCCACTACCTGG - Exonic
985765436 5:1777061-1777083 CACCCACCCATGCCTCCGTGGGG + Intergenic
985837726 5:2282725-2282747 AACGCACCCAGGCCAACGACAGG - Intergenic
985909332 5:2866555-2866577 GACCCACCCTGGCCAATGCCTGG - Intergenic
986063872 5:4216835-4216857 CACCCACTCATGCCTCAGCCTGG - Intergenic
987403540 5:17502331-17502353 CAGCCAGCAAAGCCACCGCCTGG - Intergenic
987411017 5:17615071-17615093 CAGCCAGCAAAGCCACCGCCTGG - Intergenic
992019566 5:72608397-72608419 CAGCCACCAAGGCCTCTGCCTGG + Intergenic
994243145 5:97447816-97447838 CACTCACCCAGGCCACCTCTGGG + Intergenic
996690084 5:126331031-126331053 CCCCCACCCATGCCACCTCTGGG - Intergenic
997378879 5:133421116-133421138 CCCACACCCAGGCCCCTGCCAGG - Intronic
998387597 5:141766782-141766804 CTCCCACCCAGGCCTTTGCCGGG + Intergenic
998406240 5:141876289-141876311 CCCGCACCCAGGCCACCGCGGGG + Intronic
999282105 5:150372704-150372726 CACCCACCCAGCCCCAGGCCTGG + Intronic
1000205186 5:159051436-159051458 CACCCCCCCACCCCGCCGCCCGG + Intronic
1001192472 5:169643664-169643686 CAACTCCCCAGGCCACCGACCGG - Intronic
1001427135 5:171630152-171630174 CGCCCACCCAGCCCTGCGCCTGG - Intergenic
1002135547 5:177105537-177105559 TCCCCACCCAGGTCAACGCCTGG + Intergenic
1002318750 5:178362556-178362578 CACCCACCCTTGCCACCGGCAGG + Intronic
1004304335 6:14487052-14487074 CAGCCACCCAAGCCACAACCCGG + Intergenic
1005875308 6:30006650-30006672 CACCCGCCCAGGTCTCGGCCAGG - Intergenic
1005946959 6:30602268-30602290 CCCCCACCCATGCTACCACCAGG + Exonic
1007130130 6:39464605-39464627 CACCTAGCCAGGCCATCGCCTGG + Intronic
1013535466 6:111059442-111059464 CACCCACCCAGTCGTCCGGCAGG + Intergenic
1018186916 6:161273618-161273640 CACCCACCCAGCCCCCTCCCGGG - Intronic
1019614580 7:1953379-1953401 ACCCCACCCAGGCCCCCGCCAGG + Intronic
1020364046 7:7360785-7360807 CACACACGCAGCCCACCTCCAGG + Intronic
1021125841 7:16850865-16850887 CACTCACCTAGGCCACTGCGGGG + Intergenic
1023828359 7:44024715-44024737 TATCCACCAAGGCCACAGCCAGG + Intergenic
1027484717 7:78747067-78747089 CAGCCAGCCAGGTCAGCGCCAGG + Intronic
1029062284 7:97810765-97810787 CCCCCAGCCAGGCTGCCGCCTGG - Intergenic
1029537628 7:101165459-101165481 CTCCTACCCCGGCCACCGCTCGG - Exonic
1029590895 7:101506471-101506493 GACCTACCCAGCCCACCCCCTGG + Intronic
1029756659 7:102578162-102578184 TATCCACCAAGGCCACAGCCAGG + Intronic
1032453686 7:132055992-132056014 CACCAACCCAGGCACCAGCCAGG + Intergenic
1033042169 7:137928574-137928596 CACCCACCCAGCCCAACCCACGG - Intronic
1034267515 7:149788415-149788437 CCTCCACACAGGCCACCACCTGG - Intergenic
1035231889 7:157470282-157470304 ACCCAACCCAGGCCAGCGCCAGG - Intergenic
1035640704 8:1182921-1182943 CTCCCACCCATGCCACCGCAGGG - Intergenic
1035729139 8:1842367-1842389 CACACACCCAGGACGCCACCAGG - Intronic
1035779431 8:2216268-2216290 CAGCCACCCAGGCCACCTCCTGG + Intergenic
1035943251 8:3928772-3928794 CACCCACCCCGCCCACCCCCGGG + Intronic
1037949089 8:23007184-23007206 CACCCACCCAGAGGACCACCAGG + Exonic
1041176908 8:55206411-55206433 CACCCACCCAGGAGCCCACCTGG + Intronic
1041839240 8:62249252-62249274 CTCCCACCCTCCCCACCGCCTGG + Intronic
1042951428 8:74204125-74204147 CACCCACCCATGGCAGCGCACGG - Intergenic
1044995821 8:97837232-97837254 CACCCACGCACTCCACAGCCTGG - Intronic
1047861660 8:128973558-128973580 CACCCAGCCAGCCTACCACCAGG + Intergenic
1049062232 8:140285610-140285632 CACCCACTCTGACCACCCCCAGG + Intronic
1049766555 8:144357955-144357977 CCCCCGCCCGGGCCACCGCTCGG + Intronic
1051170441 9:14314986-14315008 CTCACACCCAGGCCGCCCCCAGG + Intronic
1051201810 9:14634176-14634198 CACCCACACATGCCACCTGCAGG + Intronic
1052999775 9:34571583-34571605 CACACACTCAGGCCCCCGCGGGG + Intronic
1054880061 9:70135357-70135379 CACCCACTCAGGTCACAGACAGG + Intronic
1056488099 9:87079083-87079105 CACCCACCCTGCCCTCCGACAGG - Intergenic
1056684259 9:88746652-88746674 CACCCACCCTGGCTACTGCTTGG + Intergenic
1057354987 9:94325363-94325385 CTCCCTCCCAGGCCAAGGCCCGG - Exonic
1057652765 9:96932271-96932293 CTCCCTCCCAGGCCAAGGCCCGG + Exonic
1057805982 9:98220324-98220346 CACCCACCGAGGGCAGTGCCTGG + Intronic
1058053357 9:100427425-100427447 CCCCCACCCCCGCCCCCGCCCGG - Intronic
1059761005 9:117337465-117337487 CAACCACCCAGTCCAATGCCAGG - Intronic
1060526630 9:124324633-124324655 CCCACCCCCAGGCCACCTCCAGG - Intronic
1061304597 9:129724987-129725009 CACCCGCCCTGGCCTCCGCAAGG - Intergenic
1061373895 9:130212942-130212964 CAGCCACCCCAGCCACCCCCAGG - Intronic
1061464351 9:130766131-130766153 CACCAACGCATGCCACGGCCCGG - Intronic
1062092758 9:134687116-134687138 CCCCCACGCATGCCACGGCCTGG - Intronic
1062222210 9:135422811-135422833 CACCCACCCAGCCCAGAGCCAGG + Intergenic
1062282006 9:135756373-135756395 CACCCACCCAGGAGCCAGCCAGG - Intronic
1062362185 9:136193342-136193364 CCCCCACCCGGACCCCCGCCAGG - Intergenic
1062506998 9:136882622-136882644 CAGCCACCCAGGCCTCCAGCAGG - Intronic
1062523390 9:136968864-136968886 CACCCCCACAGCCCAGCGCCCGG + Intergenic
1062529634 9:136994233-136994255 CACCCTCCCAGGCCGCACCCAGG + Intergenic
1062645753 9:137547348-137547370 CACCAACCAAGGCCAGGGCCAGG + Exonic
1062696411 9:137878246-137878268 CCCCCACCCCGGTCCCCGCCCGG - Intronic
1185468185 X:368206-368228 CACCCACCCCGGGCACTGACGGG + Intronic
1185468217 X:368280-368302 CACCCACCTTGGGCACCGACGGG + Intronic
1185468247 X:368354-368376 CACCCACCCCGGGCACCGACGGG + Intronic
1185468279 X:368428-368450 CACCCACCCCGGGCACTGACGGG + Intronic
1185468297 X:368466-368488 CACCCACCCCGGGCACCGACGGG + Intronic
1185468315 X:368503-368525 CACCCACCTTGGGCACCGACGGG + Intronic
1185468330 X:368540-368562 CACCCACCCCGGGCACCGACGGG + Intronic
1185468347 X:368577-368599 CACCCACCCCGGGCACCGACCGG + Intronic
1185468366 X:368614-368636 CACCCACCCTGGGCACCGACGGG + Intronic
1185468382 X:368651-368673 CACCCACCCTGGGCACCGACCGG + Intronic
1185468400 X:368688-368710 CACCCACCCTGGGCACCGACGGG + Intronic
1185468417 X:368725-368747 CACCCACCTTGGGCACCGACGGG + Intronic
1185468447 X:368799-368821 CACCCACCCCGGGCACTGACGGG + Intronic
1185468463 X:368836-368858 CACCCACCTTGGGCACCGACCGG + Intronic
1185468479 X:368873-368895 CACCCACCCTGGGCACCGACGGG + Intronic
1186523791 X:10229093-10229115 CACCCATCCAGCCCTCCACCTGG - Intronic
1187940435 X:24375843-24375865 CACCCAGCCAGCCCACAGACAGG + Intergenic
1192583711 X:72304838-72304860 CACCCACCCTGACCCCAGCCTGG + Intronic
1195394909 X:104399904-104399926 CCCCCACCCCGCCCACCCCCTGG - Intergenic
1198107555 X:133475963-133475985 CACCCACCCAGGGCACTGGCAGG - Intergenic
1199600969 X:149540760-149540782 CAGCCAACCAGGCCAAGGCCAGG - Exonic
1199892020 X:152094439-152094461 CACCCACCCCACCCACCCCCAGG - Intergenic
1199985599 X:152947796-152947818 CACCCACCCAGCCAAGGGCCTGG - Intronic
1200077431 X:153558101-153558123 CACCCCCCCAGGGCATCGCAGGG + Exonic