ID: 1185326551

View in Genome Browser
Species Human (GRCh38)
Location 22:50228454-50228476
Sequence GCCACTGAGACAGCTGTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185326551_1185326554 -9 Left 1185326551 22:50228454-50228476 CCGACCACAGCTGTCTCAGTGGC No data
Right 1185326554 22:50228468-50228490 CTCAGTGGCACCAGCATCCTGGG No data
1185326551_1185326557 9 Left 1185326551 22:50228454-50228476 CCGACCACAGCTGTCTCAGTGGC No data
Right 1185326557 22:50228486-50228508 CTGGGCAACGCCACAGCAGCAGG No data
1185326551_1185326558 18 Left 1185326551 22:50228454-50228476 CCGACCACAGCTGTCTCAGTGGC No data
Right 1185326558 22:50228495-50228517 GCCACAGCAGCAGGCCCTGCAGG No data
1185326551_1185326553 -10 Left 1185326551 22:50228454-50228476 CCGACCACAGCTGTCTCAGTGGC No data
Right 1185326553 22:50228467-50228489 TCTCAGTGGCACCAGCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185326551 Original CRISPR GCCACTGAGACAGCTGTGGT CGG (reversed) Intronic