ID: 1185326555

View in Genome Browser
Species Human (GRCh38)
Location 22:50228478-50228500
Sequence TGTGGCGTTGCCCAGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185326555_1185326564 11 Left 1185326555 22:50228478-50228500 CCAGCATCCTGGGCAACGCCACA No data
Right 1185326564 22:50228512-50228534 TGCAGGTCACACTAAGACAGGGG No data
1185326555_1185326565 19 Left 1185326555 22:50228478-50228500 CCAGCATCCTGGGCAACGCCACA No data
Right 1185326565 22:50228520-50228542 ACACTAAGACAGGGGCACCCTGG No data
1185326555_1185326558 -6 Left 1185326555 22:50228478-50228500 CCAGCATCCTGGGCAACGCCACA No data
Right 1185326558 22:50228495-50228517 GCCACAGCAGCAGGCCCTGCAGG No data
1185326555_1185326563 10 Left 1185326555 22:50228478-50228500 CCAGCATCCTGGGCAACGCCACA No data
Right 1185326563 22:50228511-50228533 CTGCAGGTCACACTAAGACAGGG No data
1185326555_1185326562 9 Left 1185326555 22:50228478-50228500 CCAGCATCCTGGGCAACGCCACA No data
Right 1185326562 22:50228510-50228532 CCTGCAGGTCACACTAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185326555 Original CRISPR TGTGGCGTTGCCCAGGATGC TGG (reversed) Intronic