ID: 1185326563

View in Genome Browser
Species Human (GRCh38)
Location 22:50228511-50228533
Sequence CTGCAGGTCACACTAAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185326555_1185326563 10 Left 1185326555 22:50228478-50228500 CCAGCATCCTGGGCAACGCCACA No data
Right 1185326563 22:50228511-50228533 CTGCAGGTCACACTAAGACAGGG No data
1185326552_1185326563 30 Left 1185326552 22:50228458-50228480 CCACAGCTGTCTCAGTGGCACCA No data
Right 1185326563 22:50228511-50228533 CTGCAGGTCACACTAAGACAGGG No data
1185326556_1185326563 3 Left 1185326556 22:50228485-50228507 CCTGGGCAACGCCACAGCAGCAG No data
Right 1185326563 22:50228511-50228533 CTGCAGGTCACACTAAGACAGGG No data
1185326559_1185326563 -8 Left 1185326559 22:50228496-50228518 CCACAGCAGCAGGCCCTGCAGGT No data
Right 1185326563 22:50228511-50228533 CTGCAGGTCACACTAAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185326563 Original CRISPR CTGCAGGTCACACTAAGACA GGG Intronic