ID: 1185326564

View in Genome Browser
Species Human (GRCh38)
Location 22:50228512-50228534
Sequence TGCAGGTCACACTAAGACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185326555_1185326564 11 Left 1185326555 22:50228478-50228500 CCAGCATCCTGGGCAACGCCACA No data
Right 1185326564 22:50228512-50228534 TGCAGGTCACACTAAGACAGGGG No data
1185326556_1185326564 4 Left 1185326556 22:50228485-50228507 CCTGGGCAACGCCACAGCAGCAG No data
Right 1185326564 22:50228512-50228534 TGCAGGTCACACTAAGACAGGGG No data
1185326559_1185326564 -7 Left 1185326559 22:50228496-50228518 CCACAGCAGCAGGCCCTGCAGGT No data
Right 1185326564 22:50228512-50228534 TGCAGGTCACACTAAGACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185326564 Original CRISPR TGCAGGTCACACTAAGACAG GGG Intronic