ID: 1185328434

View in Genome Browser
Species Human (GRCh38)
Location 22:50239476-50239498
Sequence CGAAATGCATATTCTCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 168}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185328430_1185328434 -9 Left 1185328430 22:50239462-50239484 CCACCGCGCCCAGGCGAAATGCA 0: 1
1: 0
2: 6
3: 150
4: 1086
Right 1185328434 22:50239476-50239498 CGAAATGCATATTCTCTGCCTGG 0: 1
1: 0
2: 2
3: 18
4: 168
1185328424_1185328434 28 Left 1185328424 22:50239425-50239447 CCTCAGCCTCCCAAAGTGCTGGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
Right 1185328434 22:50239476-50239498 CGAAATGCATATTCTCTGCCTGG 0: 1
1: 0
2: 2
3: 18
4: 168
1185328427_1185328434 19 Left 1185328427 22:50239434-50239456 CCCAAAGTGCTGGGATTACAGAT 0: 5300
1: 89088
2: 313361
3: 241102
4: 147967
Right 1185328434 22:50239476-50239498 CGAAATGCATATTCTCTGCCTGG 0: 1
1: 0
2: 2
3: 18
4: 168
1185328426_1185328434 22 Left 1185328426 22:50239431-50239453 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1185328434 22:50239476-50239498 CGAAATGCATATTCTCTGCCTGG 0: 1
1: 0
2: 2
3: 18
4: 168
1185328428_1185328434 18 Left 1185328428 22:50239435-50239457 CCAAAGTGCTGGGATTACAGATG 0: 5024
1: 81336
2: 213729
3: 253622
4: 203117
Right 1185328434 22:50239476-50239498 CGAAATGCATATTCTCTGCCTGG 0: 1
1: 0
2: 2
3: 18
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185328434 Original CRISPR CGAAATGCATATTCTCTGCC TGG Intronic
901437241 1:9254896-9254918 AGAAATGCATTCTCTCTGCGGGG + Intronic
904126093 1:28240338-28240360 AGAAATGCAAATTCTCGGCAGGG + Intronic
904271116 1:29350651-29350673 TGAAATGAATAATCTCTGCCGGG + Intergenic
905355871 1:37384164-37384186 AGAAATGCACATTCTTGGCCAGG + Intergenic
907393706 1:54175277-54175299 CCAAGTGCTTATTCTGTGCCAGG + Intronic
908411662 1:63872139-63872161 AGAAATTCATATTTTATGCCAGG + Intronic
908983252 1:69984217-69984239 AGAAATGTATAATCTCTGCTGGG - Intronic
909246969 1:73298719-73298741 CGAAATGACTCTTCTCGGCCGGG - Intergenic
909327333 1:74367315-74367337 TGTAATGAATATTCTCAGCCTGG + Exonic
909408188 1:75316826-75316848 AGAAATGCTTATTCACTACCAGG + Intronic
910802994 1:91164104-91164126 CGGAATGCAAAATCTCTGCCAGG + Intergenic
918504660 1:185238731-185238753 TTAAATGCCTATTATCTGCCCGG - Intronic
918771469 1:188566296-188566318 TGTAATGCAAATTGTCTGCCTGG - Intergenic
919263135 1:195224142-195224164 ATAAATGCATATTTTCTTCCTGG + Intergenic
919447173 1:197721362-197721384 AGAAATGCAGTTTCTCGGCCAGG - Intronic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1064103036 10:12479488-12479510 AGAAATGCAGCTTCTCGGCCGGG - Intronic
1064617727 10:17179471-17179493 TAAAATTCATATTCACTGCCTGG + Intronic
1068133007 10:52918652-52918674 AGAAATGCTTATTCCATGCCAGG + Intergenic
1072260712 10:93668955-93668977 CTTACTGCATAATCTCTGCCGGG + Exonic
1073770116 10:106726789-106726811 AGAAATGCAGACTCTCGGCCGGG + Intronic
1081202289 11:40231530-40231552 TTAAATGCATATTTTGTGCCAGG + Intronic
1083214672 11:61210888-61210910 CCAAGTGCCTACTCTCTGCCAGG - Intronic
1083217556 11:61229717-61229739 CCAAGTGCCTACTCTCTGCCAGG - Intronic
1083230278 11:61313107-61313129 AGAAATGCAGATTCTCTGGCTGG - Intronic
1083616710 11:64029833-64029855 CAAAAAGCATATTCTCTGCTGGG + Intronic
1085861350 11:80239675-80239697 AGAAATGCATAGTCTCAGTCTGG + Intergenic
1088200833 11:107331954-107331976 CCAAATGCATTTCCTCTGACTGG - Intronic
1088373430 11:109115819-109115841 ATAAATGCATATTATTTGCCTGG - Intergenic
1090932366 11:131309758-131309780 TGAAATGCATATTCTCAGGGAGG + Intergenic
1093705192 12:22267405-22267427 CAAAAGGAATATTCTCTGCTTGG - Intronic
1094674598 12:32607273-32607295 TTAAATGCATATTCTCTAGCTGG + Intronic
1095474071 12:42567208-42567230 CTGAATACATATTCTGTGCCAGG + Intronic
1095541941 12:43320388-43320410 GAAAATGCAGATTCCCTGCCAGG + Intergenic
1096754135 12:53784642-53784664 AGAAATGCAAATTCTGGGCCAGG - Intergenic
1099141030 12:78975399-78975421 CTAAATGCCTAGTCTATGCCAGG - Intronic
1101130861 12:101689877-101689899 AGAAATGAAAACTCTCTGCCGGG + Intergenic
1103385608 12:120530073-120530095 TGAAATGAAAATTCTCTTCCTGG + Intronic
1104547548 12:129725998-129726020 TGACATGCATATCCTCTACCTGG - Intronic
1105667024 13:22571208-22571230 TTAAAGGCATATTCTCTGGCTGG + Intergenic
1109063183 13:57647392-57647414 TGAAAAGCATATTTTCTGCTGGG - Intronic
1109606822 13:64707241-64707263 CCTAATGCTTATTCTCTTCCAGG + Intergenic
1109750196 13:66681850-66681872 TGAAATGCCTAGTCTATGCCAGG - Intronic
1115471902 14:33776674-33776696 GGAAAAGCATATTGTGTGCCAGG + Intronic
1116411093 14:44624804-44624826 CAAGAAGCAGATTCTCTGCCTGG + Intergenic
1120291116 14:82572031-82572053 CTAAATGCTTACTCTGTGCCAGG + Intergenic
1122255993 14:100476914-100476936 CGAAATACCTATTATGTGCCAGG + Intronic
1122457192 14:101863599-101863621 AGAAATGCAGATTCTTGGCCAGG + Intronic
1125066508 15:35492632-35492654 ATAAATGCATGCTCTCTGCCAGG + Intronic
1125211786 15:37225469-37225491 TGAAATGCCTATTATGTGCCCGG + Intergenic
1125677505 15:41510754-41510776 CGAAATGCACATTATCAGCTGGG - Intronic
1126600156 15:50419973-50419995 CTGAATGCATGTTCTATGCCAGG - Intergenic
1127110558 15:55664880-55664902 AGAAATGCAAAATTTCTGCCAGG - Intronic
1128242151 15:66108436-66108458 AAAAATGTATATTCTATGCCAGG + Intronic
1128953138 15:71908454-71908476 AGAAATGGATATTATCGGCCGGG - Intronic
1130084856 15:80769347-80769369 AGAAATGCATATTCTAAGGCTGG + Intergenic
1131310198 15:91283747-91283769 CAAAATGCATCCTCTCAGCCAGG - Intronic
1134768797 16:16785952-16785974 TCAAATGTGTATTCTCTGCCAGG - Intergenic
1134908217 16:18000338-18000360 AGAAATGCAAATTCTCAGCTGGG + Intergenic
1135786491 16:25353951-25353973 AGAAATGCAAATTCTCTGCCAGG + Intergenic
1138188119 16:54992368-54992390 TAAAAGGCATATTCTCGGCCAGG - Intergenic
1138293501 16:55867840-55867862 TGACATGCTTATTTTCTGCCTGG - Intronic
1143469639 17:7164374-7164396 AAAAATGCATATTATCGGCCGGG - Intergenic
1143655879 17:8293391-8293413 CCAAATGCTTACTGTCTGCCAGG + Intronic
1143985103 17:10906473-10906495 TGAAATAGATATTCTCTTCCTGG - Intergenic
1144992578 17:19243832-19243854 AAAAATACACATTCTCTGCCAGG - Intronic
1146059344 17:29596367-29596389 CGCTATGCATGTTCTCTGCCAGG + Intronic
1146101498 17:29986940-29986962 CAAAATGAATATACTCGGCCGGG - Intronic
1151186237 17:72365954-72365976 AGCATTGCATATTCTCTTCCTGG - Intergenic
1151256721 17:72883089-72883111 CTAAAAGCATTTTCTCGGCCTGG - Intronic
1153396644 18:4629167-4629189 CTAAATGACTACTCTCTGCCAGG - Intergenic
1153564552 18:6406416-6406438 CGAAAAGCACATTCTCTACAAGG - Intronic
1155159520 18:23184405-23184427 AGAAATGTATTTTCTCGGCCGGG + Intronic
1155209454 18:23587719-23587741 AGAAATGTAAATTCTCAGCCAGG + Intergenic
1156330458 18:36116941-36116963 AGAAATGCATACTCCCGGCCAGG + Intronic
1156389373 18:36636233-36636255 AGAAATGCTTATTCTCTAGCTGG - Intronic
1162547168 19:11337998-11338020 ACAAATGCTTACTCTCTGCCGGG + Intronic
1165557165 19:36644226-36644248 AGAAATACATATTCTCTGCTGGG - Intronic
1165734308 19:38166056-38166078 CTTAATGCATATTCTCAGCCGGG - Intronic
1166287099 19:41837888-41837910 TCAAATGCCTACTCTCTGCCAGG - Intronic
1167221300 19:48200384-48200406 AGAAATGCAGATTCTCGGCTGGG + Intronic
1168410505 19:56137076-56137098 AGAAATGCAGATTCTCGGCTGGG - Intronic
926117665 2:10223630-10223652 GGACAGGCATATTCTCTGTCGGG + Intergenic
929445828 2:42000391-42000413 CCAAATGCTTACTCTGTGCCAGG + Intergenic
931550240 2:63436752-63436774 GGGAAGGCATATTCTCTGCTAGG - Intronic
935279267 2:101503811-101503833 TGAAATGCACGTTCTCGGCCGGG + Intergenic
935717096 2:105948760-105948782 AGAAATACAGATTCTCGGCCGGG - Intergenic
936056123 2:109263556-109263578 CTAAAAGCAAATTCTCTACCTGG - Intronic
937556434 2:123163737-123163759 AGAAATGCAGAATCTCTGTCTGG + Intergenic
939658962 2:144863703-144863725 CTAAATGCATAGTCTGCGCCGGG - Intergenic
939677334 2:145088620-145088642 CAAAATTCACTTTCTCTGCCTGG - Intergenic
940808743 2:158218899-158218921 CGAAATGCACATTATTTCCCAGG - Intronic
940825141 2:158402726-158402748 TCAAAGGAATATTCTCTGCCAGG + Intronic
946760004 2:222984094-222984116 AGAAATGCAGAATCTCAGCCAGG - Intergenic
947572145 2:231244663-231244685 CAAAATCCACATTCTCAGCCAGG - Intronic
948394516 2:237634381-237634403 CTAAATGAATATTCACTGGCAGG + Intronic
948726342 2:239936313-239936335 AGCAATGCCCATTCTCTGCCTGG - Intronic
1168966492 20:1901641-1901663 CGAGATGGATTTTCCCTGCCAGG + Intronic
1169269048 20:4185398-4185420 AGAAATGCAGATTCTCAGCCTGG + Intronic
1169269082 20:4185682-4185704 AGAAATGCAGATTCTCAGCCTGG + Intronic
1169529890 20:6473782-6473804 CCAAATGCACATTCCCTGCATGG + Intergenic
1171309992 20:24138285-24138307 AGAAATGCACATTCTTGGCCCGG - Intergenic
1172695718 20:36821555-36821577 CAAAATGCATATTCTTAGCCGGG + Intronic
1172823601 20:37760782-37760804 CTAAATGCTTAATATCTGCCAGG - Intronic
1172950096 20:38717700-38717722 CCAAATGCTTATTCTCTGCTAGG - Intergenic
1181508075 22:23375132-23375154 TGACATGCTTATTGTCTGCCTGG - Intergenic
1185328434 22:50239476-50239498 CGAAATGCATATTCTCTGCCTGG + Intronic
949744357 3:7271262-7271284 AGAAATGCAGAATCTCGGCCGGG + Intronic
950081572 3:10226128-10226150 TGAAAACCATCTTCTCTGCCTGG + Intronic
961294829 3:125876453-125876475 TGAAATGCATGTTCTCAGCTGGG + Intergenic
961347234 3:126271643-126271665 CTAGATGAATATTCCCTGCCTGG - Intergenic
961420039 3:126796047-126796069 TGAAATGAATATTCTTGGCCAGG + Intronic
961792486 3:129386135-129386157 CAAACTGAATATTCTCAGCCAGG - Intergenic
962114617 3:132490371-132490393 CGAAGTCCATATCCTCTGGCAGG - Intronic
963247369 3:143075358-143075380 AGAAATGCAGATTCTCGGCCAGG + Intergenic
963875789 3:150472972-150472994 AGAAATGTATATTTTCTGGCTGG + Intergenic
970615471 4:17764767-17764789 TAAAATGCAAATTCTCGGCCAGG + Intronic
971320452 4:25601238-25601260 AGAAGTGCAGATTCTCAGCCAGG + Intergenic
971507484 4:27381974-27381996 GGAAATGCATATTCACAGCAGGG + Intergenic
972318488 4:37950144-37950166 TCATATGCATATTCTCAGCCTGG - Intronic
973040853 4:45468761-45468783 CCAAATGCCTATTCTCTCCTGGG + Intergenic
977231404 4:94454518-94454540 GCAAATGCTTACTCTCTGCCTGG + Intronic
980520891 4:133932572-133932594 CTGAATGCATATTGTGTGCCAGG - Intergenic
980841818 4:138271184-138271206 CTAAATTCATATTTTGTGCCAGG - Intergenic
986104675 5:4648570-4648592 CGAGATGCAGCTTCTCTGTCAGG + Intergenic
989285755 5:39697813-39697835 AGAAATGCAGATTCTATTCCTGG - Intergenic
990102177 5:52204522-52204544 CTAAATTCATACTCTCTCCCTGG + Intergenic
991732008 5:69598706-69598728 AGAAATGCAAATTCTTGGCCAGG + Intergenic
991808442 5:70453850-70453872 AGAAATGCAAATTCTTGGCCAGG + Intergenic
991862943 5:71029151-71029173 AGAAATGCAAATTCTTGGCCAGG - Intergenic
992388620 5:76310068-76310090 TGGAATGCATATCCTGTGCCAGG + Intronic
997029721 5:130112371-130112393 AGAAATGCAAATTCTCAGACCGG + Intronic
998013661 5:138715326-138715348 CCAAATACCTATTCTCAGCCGGG - Intronic
998490352 5:142541024-142541046 CGAAATGCAAAGTCCCAGCCGGG + Intergenic
1000501100 5:162051644-162051666 GGAAATGCAAATTCACTACCAGG - Intergenic
1001546282 5:172572559-172572581 AGAGATGCATGTTGTCTGCCAGG + Intergenic
1006466539 6:34197942-34197964 TGAAATGCATACTCTGTGCCAGG + Intergenic
1006920111 6:37622213-37622235 GGAAATGCATATTCTATTCTAGG - Intergenic
1008018832 6:46552787-46552809 AGAAATGCAAATTCTGGGCCAGG + Intronic
1008348962 6:50465311-50465333 CGACATGAATATTTTGTGCCAGG - Intergenic
1011401477 6:86966742-86966764 TGAAATACCTTTTCTCTGCCTGG - Intronic
1012026981 6:94008337-94008359 CCAGGTGCAGATTCTCTGCCCGG - Intergenic
1013369595 6:109457181-109457203 GGAAATGCCTGTTCTCTGCCAGG + Intergenic
1015827646 6:137331792-137331814 CCAAATGCATATTGTATGCAGGG - Intergenic
1016700622 6:147049859-147049881 TGAAATGCAGATGCTCAGCCTGG + Intergenic
1016908956 6:149178193-149178215 CCAAATGCCTATTATGTGCCAGG + Intergenic
1020321467 7:6941591-6941613 CGAAATGCAGGTTCTCAGCTGGG - Intergenic
1020896538 7:13947069-13947091 TTAAATTCATATTCTCAGCCAGG - Intronic
1021700818 7:23317895-23317917 CTATATGCTTATTCTGTGCCGGG + Intronic
1022169051 7:27805539-27805561 AGAAATGCATATGCTTTGCCGGG + Intronic
1024154183 7:46603424-46603446 AGAAATGCACATTCTCAGCTGGG - Intergenic
1024779529 7:52831452-52831474 AGAAATGCAAATTTTCTGACAGG - Intergenic
1026254632 7:68699831-68699853 AAAAATGCATATTCTTGGCCAGG + Intergenic
1026431732 7:70354429-70354451 CTAAGTGCATACTCTGTGCCAGG + Intronic
1026570300 7:71523452-71523474 AGAAATGCAGATTCTTGGCCAGG + Intronic
1027690911 7:81343567-81343589 TTAAATGAATATTCTCAGCCGGG - Intergenic
1029592233 7:101514795-101514817 GGAGATGCAGATTCTCTGCGAGG - Intronic
1030103654 7:105968653-105968675 GAAAATGCATATGCTCGGCCAGG - Intronic
1031322020 7:120342317-120342339 CCAAATGCTTATTCTATGCCAGG - Intronic
1031337562 7:120554701-120554723 AGAAATGTAAATTCTCGGCCAGG - Intronic
1034034381 7:147803447-147803469 GAAACTGCATGTTCTCTGCCAGG + Intronic
1034252801 7:149705942-149705964 CGCAATGCATATTCTGTGCCAGG - Intergenic
1037678482 8:21073048-21073070 AGAAATTCAAATGCTCTGCCCGG - Intergenic
1038212414 8:25531794-25531816 CTGAATGCATATTATGTGCCCGG + Intergenic
1039225803 8:35387062-35387084 AGAAATGCAGATTCTCAGGCCGG + Intronic
1041798545 8:61772703-61772725 AAAAATGCAGATTCTCGGCCGGG - Intergenic
1042532322 8:69828786-69828808 TGAAATGCATATTCTGTGCTAGG - Intronic
1044937210 8:97304720-97304742 AGAAATGCAAATTCTCAGCCTGG + Intergenic
1045374850 8:101561401-101561423 AGAAATGAATAATCTTTGCCTGG - Intronic
1056110965 9:83394277-83394299 CAAAAGGCAAATTCTCTCCCTGG + Intronic
1056599092 9:88032113-88032135 AGAAATGCAGATTCTTGGCCAGG + Intergenic
1057595553 9:96413284-96413306 TGAAATGCTTACTCTGTGCCAGG + Intronic
1057836571 9:98450054-98450076 CAATATGCACACTCTCTGCCGGG - Intronic
1058380114 9:104368356-104368378 AGAAATGCATTATCTCAGCCGGG - Intergenic
1058523439 9:105834568-105834590 AGAAATGCAAATTCTCAGGCTGG + Intergenic
1059430198 9:114245450-114245472 TGAAATGCACATTCTGGGCCAGG - Intronic
1059502331 9:114765902-114765924 AGAAATGCAAATGCTCTGCAAGG - Intergenic
1059876375 9:118640229-118640251 AAAAATGCATGTTTTCTGCCAGG - Intergenic
1060376332 9:123117792-123117814 CCGAGTGCATGTTCTCTGCCTGG - Intronic
1061755299 9:132808358-132808380 GGAGATGCTTATTCTGTGCCTGG - Intronic
1186009510 X:5113936-5113958 AGAGATGCAGTTTCTCTGCCTGG + Intergenic
1190624443 X:52323210-52323232 TGCAATGCATATTCTTAGCCTGG + Intergenic
1194073898 X:89364200-89364222 CTAAATACATATTGTCTACCTGG - Intergenic
1196203584 X:112913582-112913604 AGAAATGCAAATTCTCAGGCTGG + Intergenic
1196576028 X:117320383-117320405 AGAAATGCAAATTCTGGGCCGGG + Intergenic
1197225467 X:123952126-123952148 AGAAATGCAAAATCTCAGCCAGG + Intergenic
1200729286 Y:6715753-6715775 CTAAATACATATTGTCTACCTGG - Intergenic
1201571733 Y:15422421-15422443 AGAGTTGCATATTCTCTTCCAGG + Intergenic
1201917772 Y:19201108-19201130 TGAAATGAATAATTTCTGCCTGG + Intergenic