ID: 1185330593

View in Genome Browser
Species Human (GRCh38)
Location 22:50250552-50250574
Sequence CAGGGTCACCAGCAGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 458}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185330583_1185330593 25 Left 1185330583 22:50250504-50250526 CCAGGGATACATACTCTGGGCTG 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1185330593 22:50250552-50250574 CAGGGTCACCAGCAGGAGCAGGG 0: 1
1: 0
2: 3
3: 51
4: 458
1185330580_1185330593 30 Left 1185330580 22:50250499-50250521 CCTGACCAGGGATACATACTCTG 0: 1
1: 0
2: 1
3: 6
4: 68
Right 1185330593 22:50250552-50250574 CAGGGTCACCAGCAGGAGCAGGG 0: 1
1: 0
2: 3
3: 51
4: 458

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185330593 Original CRISPR CAGGGTCACCAGCAGGAGCA GGG Intronic
900323825 1:2097677-2097699 CACGGGCCCCACCAGGAGCACGG - Intronic
900385178 1:2407321-2407343 CTGTGTCACCAGCAGGAGGGTGG - Intronic
900410422 1:2510149-2510171 CAGGATGACCTGCAGGAGGAGGG + Exonic
900929322 1:5726358-5726380 CAGAGGCAGCTGCAGGAGCAAGG + Intergenic
900929435 1:5726926-5726948 CAGAGGCAGCTGCAGGAGCAAGG - Intergenic
901401038 1:9015184-9015206 CAGGGTCAGCAGCTGCAGCAGGG + Exonic
901635031 1:10666514-10666536 CAGGAGCTCCAGCAGGTGCAGGG + Intronic
902282506 1:15384675-15384697 CAGCGTCCCCAGCTGGAGCTGGG + Intronic
902456422 1:16536681-16536703 CAGTGGGACCAGCAGGAGCCTGG - Intergenic
902495741 1:16871230-16871252 CAGTGGGACCAGCAGGAGCCTGG + Intronic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
903675609 1:25062818-25062840 CTGAGTCTCCAGCAGGGGCAGGG - Intergenic
903791374 1:25895488-25895510 CTGGGCCTCCAGCAGGGGCAGGG + Intronic
904259438 1:29280003-29280025 CAGGGTCACAAGCTGGAGCTTGG - Intronic
904321239 1:29698896-29698918 CAGGGGCAGGGGCAGGAGCAGGG - Intergenic
904410496 1:30322098-30322120 CAGGGTCACCTGCTGAAGAAAGG + Intergenic
904598569 1:31661677-31661699 CAGGGGGGCCAGCAGGACCAGGG + Exonic
905851768 1:41280036-41280058 CAGGGGCATCTGCAGGAGAAGGG - Intergenic
905940728 1:41861171-41861193 CATGGTCCCCAGATGGAGCATGG - Intronic
906323208 1:44829223-44829245 CAGGGCCACCAGCAGTACCCCGG + Exonic
907309098 1:53529240-53529262 CTGGGTCACCTGCAGGAGCCTGG + Intronic
909351786 1:74662142-74662164 CAGGGCCACATGCAAGAGCATGG - Intronic
910102757 1:83596383-83596405 CACCTTCACCAGAAGGAGCAGGG - Intergenic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
911474302 1:98357442-98357464 GAGGGTAAGCAGCAGCAGCATGG - Intergenic
912170980 1:107098776-107098798 CAGGGTCACCAGGCAGTGCAGGG - Intergenic
912694720 1:111832599-111832621 CTAGGTAACCAGCAGGACCAGGG - Intronic
912788633 1:112628983-112629005 CAGGAGCAACAGCAGAAGCAGGG - Intronic
914320236 1:146552079-146552101 CAGGGACACTAGCAGGAGACTGG + Intergenic
916273432 1:162968347-162968369 CAGAGACACAGGCAGGAGCAAGG - Intergenic
916852130 1:168714212-168714234 CAGACTCACCAGCAGGAATATGG + Exonic
917718940 1:177767454-177767476 CATGTTCACCAACAGGAGAATGG + Intergenic
920250539 1:204619627-204619649 CAGGCTCAGCAGCTGGGGCAGGG + Exonic
920398827 1:205664588-205664610 CAGGTTGACCAGCAAGAGCTGGG + Exonic
921039589 1:211416840-211416862 CAGGGTCCCCAGCAGGAAGGTGG - Intergenic
921909283 1:220528982-220529004 CAGGGTCTCCACCTGGAGCCCGG + Intronic
922291509 1:224212688-224212710 CAGGCTGACCAGCAGAAACATGG + Intergenic
922762959 1:228143734-228143756 CTGGGTGAGCAGCAGGAGCCAGG + Intronic
922915371 1:229253015-229253037 CAGGGACAGCAGCCGGGGCAGGG - Intergenic
923000397 1:230002283-230002305 CAGGTGCAGCAGGAGGAGCAAGG + Intergenic
923341284 1:233009033-233009055 CAGTGTGGCCAGTAGGAGCAAGG + Intronic
924886954 1:248229213-248229235 CTAGGGAACCAGCAGGAGCAGGG + Intergenic
1063016373 10:2081680-2081702 AAGGGTTATCAGCAGAAGCAAGG - Intergenic
1063277835 10:4590598-4590620 CAGGATGAACAGCAGGAGCCAGG + Intergenic
1063623057 10:7666872-7666894 CAGCCCCAGCAGCAGGAGCATGG + Exonic
1065359078 10:24872220-24872242 CAAGGGCAGTAGCAGGAGCATGG - Intronic
1065804285 10:29380676-29380698 CAGCGTAACCAGCAGGAGTTGGG - Intergenic
1065944899 10:30597344-30597366 CAGTGTAACCAGCAGGAGTTGGG + Intergenic
1066431610 10:35357166-35357188 CAGGGGCAGGGGCAGGAGCAGGG - Intronic
1067145599 10:43691612-43691634 CAGGGCTGCCAGCAGGGGCATGG - Intergenic
1067941367 10:50659750-50659772 CAGGGGCACCAGCAGGCGCGAGG - Intergenic
1069091470 10:64204518-64204540 TAGGGTCAGCAGCAGCAGCAGGG - Intergenic
1069837799 10:71319917-71319939 CTGGGTCACCTGCGGGAGCCCGG - Intronic
1070539559 10:77406419-77406441 CAGGGGCACGAGAAGAAGCAAGG - Intronic
1070614788 10:77961402-77961424 CAGGGTCTCCATGGGGAGCAGGG - Intergenic
1070862605 10:79684712-79684734 TAGGGGCACCAGCAGGCGCGAGG - Intergenic
1072008866 10:91286269-91286291 CAGGGTTTGCAGGAGGAGCAGGG - Intergenic
1072207803 10:93220570-93220592 CAGGGTCCCCACCAGCAGGAAGG + Intergenic
1072436058 10:95415648-95415670 GAGGGTCAGGAGGAGGAGCAGGG + Intronic
1072996445 10:100249050-100249072 CAGGGGCAGCTGGAGGAGCATGG - Intronic
1073091132 10:100940773-100940795 CAGGGGCAGGAGCAGGGGCAGGG - Intronic
1074530876 10:114297837-114297859 CAGGGTTAACAGGAGGAGCCAGG - Intronic
1075383155 10:122035099-122035121 CAGGGACACCCGTAGGAGCCTGG - Intronic
1075677812 10:124308430-124308452 CGAGGTCACCAGCAGGGCCAAGG + Intergenic
1075925432 10:126248052-126248074 CTGTGCCACCAGCAGGTGCAGGG - Intronic
1076221284 10:128734956-128734978 CAGGGTCAGAAGAGGGAGCACGG + Intergenic
1076227721 10:128793733-128793755 CACGGTCACCAGCTGGAGGCTGG + Intergenic
1076244311 10:128934155-128934177 CAGGGTCATCAGCCTGTGCAGGG - Intergenic
1076776681 10:132701705-132701727 CAGAGTCATCAGCAGGTTCAGGG - Intronic
1076885005 10:133258188-133258210 CAGGGTCCCCAGGATGACCAGGG - Intergenic
1076930219 10:133527439-133527461 CATGGACACCAGCAGGAGGAAGG - Exonic
1077017828 11:404715-404737 CTGGGCCACCAGGAGGGGCAGGG + Exonic
1077188346 11:1245379-1245401 CAGGGCCACCTCCAGGACCACGG + Exonic
1077192603 11:1261729-1261751 CGGGGTGGGCAGCAGGAGCACGG - Exonic
1077235844 11:1481703-1481725 CAGGGGCAGGAGCAGGGGCAGGG + Intronic
1077284170 11:1758526-1758548 GAGAGTCACCGGCAGGAGCCTGG - Intronic
1077335749 11:2003201-2003223 CAGGGCCTCCAGCAGGAACAGGG - Intergenic
1079031672 11:16990849-16990871 CAGGGAGACCCTCAGGAGCATGG + Intronic
1079107018 11:17578291-17578313 CAGGGGCAGCAGCTGGAGGATGG - Intronic
1079152789 11:17915931-17915953 GAGGGACAGCAGCAGGTGCAGGG + Intronic
1079441244 11:20516786-20516808 CATGTTCACCAGCAGGTGAATGG - Intergenic
1080381569 11:31777266-31777288 CAGGGTCACAAGGAGGAGGATGG - Intronic
1080408275 11:31999577-31999599 CTGGGTCACCAGCATGGGCCAGG - Intronic
1081380380 11:42407510-42407532 CAGCGCCACCAGCAGGAGAGTGG + Intergenic
1081743854 11:45459415-45459437 CAGGGTCTCCTGCAAGAGCCGGG + Intergenic
1082629847 11:55529103-55529125 CAAGGACAACAGCATGAGCAAGG - Intergenic
1082812006 11:57483966-57483988 CAGAGGCACAAGCAGGTGCAGGG + Intergenic
1083448739 11:62728187-62728209 TCGGTTTACCAGCAGGAGCAAGG - Intronic
1083718360 11:64591865-64591887 CACGGCCACCAGCTGGAGCGAGG + Exonic
1083779906 11:64912376-64912398 CGGGGTCAGGAGCAGGTGCAGGG + Exonic
1084146722 11:67268974-67268996 TTGGGTCACCATCAGCAGCATGG + Intronic
1084195487 11:67522010-67522032 CACAGTCATCAGTAGGAGCAGGG - Intronic
1084978058 11:72814168-72814190 GAGGGTCATAAGCAGGAGCGAGG - Intergenic
1085258920 11:75193254-75193276 CAGGACCACCAGCAGGAAGATGG - Exonic
1085284171 11:75349451-75349473 CAGGGTCTCCAACAGGTGCCTGG + Intronic
1085409538 11:76283033-76283055 CAGAGTCAGCAGCAGGGGCCAGG - Intergenic
1085447985 11:76614224-76614246 CAGGGTCTCGGGCAGCAGCAAGG - Intergenic
1085477092 11:76795627-76795649 CACGGCCAGCAGCAGCAGCAGGG - Exonic
1087907532 11:103716521-103716543 AGGGGTCACCAGCAGGAGTGGGG - Intergenic
1089679702 11:120112361-120112383 CAGGGTCAGGAGGAAGAGCAGGG + Exonic
1089702884 11:120255863-120255885 CAAGGTCACCAGAGGGAGGAAGG - Intronic
1090071322 11:123546934-123546956 CAGAATGACCAGTAGGAGCAGGG + Intronic
1091273778 11:134335909-134335931 CACCATCACCAGCAGGGGCAGGG + Intronic
1091301499 11:134510764-134510786 CAGGGGCAGCTGGAGGAGCAGGG - Intergenic
1091329975 11:134724759-134724781 CAGGGCCCCCAGCAGAGGCAGGG - Intergenic
1202818733 11_KI270721v1_random:58383-58405 CAGGGCCTCCAGCAGGAACAGGG - Intergenic
1092151168 12:6249877-6249899 CAGAGTCACCAGCAACAGCTGGG - Intergenic
1092709752 12:11323280-11323302 AAGAGAAACCAGCAGGAGCAAGG + Intergenic
1095985289 12:47995272-47995294 CAGGGGGACCAGGAGGACCACGG + Exonic
1096157552 12:49348964-49348986 CAGGGTCAGCATCCAGAGCAGGG - Exonic
1096231883 12:49901273-49901295 GAGGGGCAGCAGCAGGTGCATGG - Exonic
1096815934 12:54201726-54201748 CAGGGTCACCAGATGGAGAGCGG - Intergenic
1100583199 12:95955722-95955744 TAGCGTCACCAGCTGGAGGATGG + Intronic
1101580970 12:106040493-106040515 CAGGGTGGGCACCAGGAGCAGGG + Intergenic
1102259707 12:111436576-111436598 CAGAGTCCCCAGCAGCAACATGG - Intronic
1103568295 12:121828094-121828116 CAGGGGCAGGAGCAGGGGCAGGG - Intronic
1103568299 12:121828100-121828122 CAGGGCCAGGGGCAGGAGCAGGG - Intronic
1103701741 12:122851711-122851733 CAGGGACCCCAGGAGGGGCAGGG - Intronic
1104512159 12:129390692-129390714 CAGAGTCACCAGCAAGAAGAAGG - Intronic
1104570984 12:129925910-129925932 CAGGGACACCAGCTACAGCATGG + Intergenic
1104640018 12:130461329-130461351 CAGGGGTGCCAGCAGGGGCAGGG + Intronic
1104761280 12:131298822-131298844 CAGGGTCCCGGGCAGGAGCGTGG + Intergenic
1104818495 12:131661970-131661992 CAGGGTCCCGGGCAGGAGCGTGG - Intergenic
1105211338 13:18258840-18258862 CAGGGTCACCCACTGGACCAGGG + Intergenic
1107936742 13:45351760-45351782 CAGGCTCACAAGCAGGTTCATGG - Intergenic
1110718707 13:78737532-78737554 CAGGGAAACCAGCAGGATCACGG + Intergenic
1114051482 14:18922050-18922072 CTCAGTCACCAGCAGGAGGAGGG - Intergenic
1114111079 14:19479874-19479896 CTCAGTCACCAGCAGGAGGAGGG + Intergenic
1114349557 14:21835516-21835538 CAGGATGACCAGCAGCAGAAAGG - Intergenic
1114407538 14:22470771-22470793 CAGGGACAAGAGCAGAAGCAAGG - Intergenic
1114493631 14:23118490-23118512 CAGGCTCAGCAGCATGAGCCGGG + Intronic
1114880243 14:26775782-26775804 AAGGATCACCAGCAGCAACATGG - Intergenic
1115305487 14:31929747-31929769 CAGTGTTACCAGCAGGATTAAGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118878986 14:69810302-69810324 CAGGGACAGCAGGAGGAGCTGGG - Intergenic
1119021992 14:71124015-71124037 CAGGATCACCAGGAGGAGGCGGG - Intergenic
1119323735 14:73746430-73746452 CAGGGATCCCAGCAGGAGTAGGG + Intronic
1119539579 14:75429107-75429129 CTGGGTCAGTAGGAGGAGCAGGG + Intronic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1121006970 14:90496593-90496615 GAGGGTGCGCAGCAGGAGCAGGG - Intergenic
1121511553 14:94516509-94516531 CAGGTGCACCAGCAGGTGAAGGG + Intronic
1122266325 14:100548598-100548620 CAGGGTGCCCAGAAGGGGCAGGG - Intronic
1122286579 14:100655922-100655944 CAGGACCACCAGCAGGAGCCAGG - Intergenic
1122355551 14:101121033-101121055 GAGGGTCACCAGGAAGTGCACGG - Intergenic
1122606533 14:102950356-102950378 CAGGGCCACCTGCCGCAGCAAGG + Intronic
1123053723 14:105559774-105559796 CAGGGGCACGGGCAGGGGCAGGG - Intergenic
1123053729 14:105559786-105559808 CAGGGGCACGGGCAGGGGCACGG - Intergenic
1123078308 14:105680197-105680219 CAGGGGCACGGGCAGGGGCAGGG - Intergenic
1123137130 14:106038307-106038329 GATGGTCAGCAGCAGGAGCGTGG + Intergenic
1123165801 14:106324112-106324134 CCGGGTCAGGAGCAGGTGCAGGG - Intergenic
1123168498 14:106349140-106349162 CCGGGTCAGGAGCAGGTGCAGGG - Intergenic
1123176187 14:106421566-106421588 CCGGGTCAGGAGCAGGTGCAGGG - Intergenic
1123194756 14:106605974-106605996 CCGGGTCAGGAGCAGGTGCAGGG - Intergenic
1123198381 14:106638976-106638998 CCGGGTCAGGAGCAGGTGCAGGG - Intergenic
1123222815 14:106872687-106872709 CCGGGTCAGGAGCAGGTGCAGGG - Intergenic
1202947497 14_KI270726v1_random:41999-42021 CCGGGTCAGGAGCAGGTGCAGGG + Intergenic
1123584140 15:21742223-21742245 CCGGGTCAGGAGCAGGGGCAGGG - Intergenic
1123620790 15:22184826-22184848 CCGGGTCAGGAGCAGGGGCAGGG - Intergenic
1124094158 15:26633318-26633340 CAGGGTCAGCTGCAGTAGGATGG - Intronic
1124496036 15:30187720-30187742 CAGCCTCAACAGCGGGAGCAGGG + Intergenic
1124549025 15:30660648-30660670 CAGGGTGACCAGCAGGTCCTAGG - Intronic
1124588068 15:31028349-31028371 CAGGTTCACCAGCAGGATGTTGG + Exonic
1124747538 15:32350927-32350949 CAGCCTCAACAGCGGGAGCAGGG - Intergenic
1125742070 15:41972288-41972310 CTGGCCCACCAGCAGGATCATGG + Exonic
1126166694 15:45659566-45659588 CAGGGTAACCACCAGAAGCTGGG - Intronic
1127315499 15:57790678-57790700 CAGGGTCAAGAGCAGGGGAATGG - Intergenic
1127903112 15:63355598-63355620 CAGGCTCTGCAGCAGGAGCCAGG - Intronic
1127906720 15:63381670-63381692 TAAGATCACCAGCAGGAGCACGG + Exonic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1129229566 15:74189251-74189273 CACGCCCACCAGCAGCAGCAGGG + Exonic
1129242729 15:74261233-74261255 CATGGTTACCCACAGGAGCAGGG + Intronic
1129395751 15:75245090-75245112 CTGGATCATCAGCAGCAGCACGG + Intergenic
1129519236 15:76175702-76175724 CAGTGTCCCCAGCAAGACCACGG - Intronic
1129741558 15:77992063-77992085 CAGCGGCAGCAGCAGGAGCAAGG + Intronic
1131265234 15:90911627-90911649 CAGGGCCACAAGCAGGAGGGTGG - Intronic
1132178279 15:99732920-99732942 GAGGGTCACCTGCAGGACCACGG + Exonic
1132558786 16:584232-584254 CAGGGCCTCCAGCAGGAGGCCGG - Intergenic
1132648483 16:1009933-1009955 CAGGGACACCAGGAGGGGCTGGG + Intergenic
1132670320 16:1099852-1099874 CGGGGTCACCAGCATGGGCTGGG + Intergenic
1132710065 16:1262554-1262576 GGGGCTCACCAGCTGGAGCAGGG + Intergenic
1132846469 16:2003161-2003183 CAGTGTCACCGCCGGGAGCAGGG + Intronic
1132873741 16:2126801-2126823 CAGGGTCTCCCCCACGAGCAGGG + Intronic
1133284445 16:4684066-4684088 CACGGTCAATAGCAGGGGCATGG - Intronic
1134202933 16:12213904-12213926 CAAGGCCACCAGAAGCAGCAGGG - Intronic
1134271969 16:12740753-12740775 CAGAGTGAACAGCAGGTGCAAGG + Intronic
1134552831 16:15145975-15145997 CAGGGTCTCCCCCACGAGCAGGG + Intergenic
1136019340 16:27430094-27430116 CTGGAGCAGCAGCAGGAGCAAGG - Exonic
1136235056 16:28908640-28908662 CAGGGCTCGCAGCAGGAGCAGGG - Exonic
1137948179 16:52755975-52755997 CAGAGTAACCAGGAGGAGCCAGG + Intergenic
1138445170 16:57059004-57059026 CAGTGTCTCCAGCAGGTACAGGG - Exonic
1138512681 16:57517721-57517743 CATGGTCACCAGCAAGAAGAGGG - Intronic
1140013297 16:71158027-71158049 CAGGGACACTAGCAGGAGACTGG - Intronic
1140350464 16:74257579-74257601 CAGAGACAACAGCATGAGCAAGG + Intergenic
1141173616 16:81705539-81705561 CAGGTTCAGCACCTGGAGCATGG - Exonic
1141642516 16:85349522-85349544 GAGTGTCCCCAGCAGGGGCAGGG + Intergenic
1142065328 16:88059167-88059189 CCCCGCCACCAGCAGGAGCATGG - Intronic
1142115672 16:88354918-88354940 CAGGGTCTCCAGTGGGGGCAGGG + Intergenic
1142172582 16:88630642-88630664 CAGGGAGGCCAGCAGCAGCAGGG + Intronic
1142204084 16:88774518-88774540 CAGAGTCCCCAGCAGCAGCCTGG + Intronic
1142292158 16:89198165-89198187 CATGGTGCCCAGCAGCAGCACGG + Exonic
1142408642 16:89904949-89904971 CAGGTTCACCAGCTGGCTCAGGG - Exonic
1142860620 17:2758649-2758671 CAGGGGCCACAGCTGGAGCATGG - Intergenic
1142867568 17:2799970-2799992 CAGGGTCTGCCCCAGGAGCAGGG + Intronic
1143296449 17:5875170-5875192 CAGGGGCACCAGCTGGAGGCAGG + Intronic
1143376868 17:6472172-6472194 CAGGGAGAACAGCAGGAGCGAGG - Intronic
1143393885 17:6576704-6576726 CAGGGCCAACAGCAAGAGGAAGG - Intergenic
1143405577 17:6675202-6675224 CTGGGTTACCAGCAGGAGTCAGG + Intergenic
1143604818 17:7976757-7976779 CAGGGACTCCTGCAGGAGGAAGG + Intergenic
1143619503 17:8072997-8073019 CAGGGCCACCGGCAGGAGGAGGG - Intronic
1144677884 17:17173469-17173491 CTGGTTCACCTGCAGGAGGACGG + Intronic
1145013146 17:19381259-19381281 CAGGCTCATCATCAGGATCATGG - Exonic
1145056054 17:19704739-19704761 CAGCGTCCCCAGCAGGGCCATGG - Intronic
1145276999 17:21437511-21437533 CAGAGGCAGCAGCAGGAGCAGGG - Intergenic
1145403620 17:22568288-22568310 CTCGGGCACCAGCAGGAGGAGGG + Intergenic
1145777080 17:27536743-27536765 CAGGGTCAGGTGCATGAGCAGGG - Intronic
1146017655 17:29246873-29246895 CAGGCTGAGCAGCAGGAGCTGGG + Exonic
1146634595 17:34494677-34494699 CCAGGTGACCAGAAGGAGCAGGG + Intergenic
1146721806 17:35129303-35129325 CCTGGGCCCCAGCAGGAGCAGGG + Intronic
1147219330 17:38919334-38919356 CAGGGGCAACAACAGGAGAATGG + Exonic
1147586626 17:41656877-41656899 CAGGGCCACCAGCAGGGCCAGGG - Intergenic
1147608774 17:41789126-41789148 CAGGGTGACAAGCAGGTGGATGG - Intergenic
1148032107 17:44628535-44628557 CAGGGGCAGCGGCAGGGGCAGGG + Intergenic
1148760734 17:49998465-49998487 GTGGGTCACCTGCAGGGGCAGGG + Intergenic
1148795669 17:50195569-50195591 CAGGGCCAGCAGCACCAGCAGGG + Exonic
1151108778 17:71650874-71650896 AAGGGTTACCTGCAAGAGCATGG + Intergenic
1151110849 17:71675876-71675898 CAGGGTCTCAATCAAGAGCAAGG + Intergenic
1151268251 17:72973257-72973279 CTGGGTCAGCAGAAGGACCAGGG + Intronic
1151550962 17:74822263-74822285 CAGGGTCTCCAACAGCAGAATGG - Intronic
1151573530 17:74939385-74939407 CAAGGGCAGCAGCAGGACCAAGG + Intronic
1151757909 17:76085274-76085296 CAGGGGCCCATGCAGGAGCAGGG + Intronic
1152143054 17:78549841-78549863 CAGGGGCCGCAGCAGGTGCAGGG - Intronic
1152215183 17:79027871-79027893 GATGGTCTCCAGCAGGGGCACGG + Intronic
1152271828 17:79329376-79329398 CAGGATCACCGGCAGGAGTGTGG - Intronic
1152319149 17:79598182-79598204 GAGGGTGACCAACAGGTGCAGGG + Intergenic
1152597698 17:81245977-81245999 CAGGGCCACCGGCTGGACCATGG - Exonic
1153979389 18:10296420-10296442 CGGTGTCAGCAGCAGGAGAAAGG - Intergenic
1155644464 18:28060802-28060824 GAGGTTCACCAGAAGGAGCCAGG - Intronic
1156986356 18:43355352-43355374 CAGGGTCAACAGTAGGATCTGGG - Intergenic
1157597329 18:48871641-48871663 CAGGGTCAGCAGCAGGGCCTTGG - Intergenic
1157614393 18:48978136-48978158 CAGGGTCAGCAGCAGGGCCTTGG + Intergenic
1157738436 18:50071166-50071188 CAGAGGAACCAGCATGAGCAAGG - Intronic
1158693948 18:59686449-59686471 CAAGGTCACACGCAGGTGCATGG - Intronic
1160162161 18:76481490-76481512 CAGGGTAACAAGCATGACCAGGG + Intronic
1160230266 18:77043531-77043553 CAGGGTCACCAGCAGGTCCCCGG - Intronic
1160752676 19:741781-741803 CAGGGACCCCAGGAGGAGGAGGG + Intronic
1160817683 19:1043629-1043651 CAGAGGCACACGCAGGAGCAAGG + Intronic
1160954582 19:1684643-1684665 CAGGGTCTCAAGCAGGGGGAGGG + Intergenic
1161771864 19:6235308-6235330 GAGGGACACCAGCAGGAGCCTGG + Intronic
1162534184 19:11253420-11253442 CAGGGTGACAAGCAGCGGCAGGG + Intronic
1162591680 19:11596404-11596426 CAAGGTCACCAGTATGTGCAGGG - Intronic
1162723582 19:12676512-12676534 CATGGCCACCAGGGGGAGCATGG + Intronic
1162916011 19:13874802-13874824 CAGAGTCACCGGCAGGAGGATGG - Intronic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1163471584 19:17500421-17500443 CATGGTCCCCACCCGGAGCAGGG + Intronic
1163510885 19:17734259-17734281 CAGGGTCACCTGCAGGTGGAGGG - Exonic
1163654591 19:18538385-18538407 CAGGGTCACCTCCAGGCACAGGG + Exonic
1163715150 19:18868996-18869018 GAGGGTCACCAGCAGCAGCGAGG + Exonic
1165763683 19:38336946-38336968 CAGGGCCAGGAGCAAGAGCAGGG + Intronic
1165763707 19:38337042-38337064 CAGGGCCAGGAGCAAGAGCAGGG + Intronic
1166392133 19:42414349-42414371 CAGGGTCGCCAGCAAGGGCTTGG - Intronic
1166898246 19:46037510-46037532 CAGGGCCATCAGCAGGACCAGGG + Intergenic
1167151017 19:47709762-47709784 CAGCGTCATCAGCAGGACCTGGG - Intergenic
1167169461 19:47821696-47821718 TATGGTCACCGGCAGGAGCTGGG + Intronic
1167529010 19:50003189-50003211 CAGGGTCCCCAGCAGGGCCTGGG - Intronic
1167581311 19:50344708-50344730 CAGAGGCAGCAGCAGCAGCAAGG + Intronic
1167584424 19:50365574-50365596 CAGAGGCAGCAGCAGCAGCAGGG + Exonic
1167595148 19:50423571-50423593 CAGGGTCACCTGCATGTCCAGGG - Intronic
1167752052 19:51387375-51387397 CATGGCCACCACCAGGAGGATGG + Exonic
1168316382 19:55486529-55486551 CAGGAACACCGGCAGGAGGAGGG - Exonic
1168663641 19:58185928-58185950 CAGGGGCACCAGTAGGAAAAGGG + Intronic
925389614 2:3486363-3486385 CAGGGTGACCAGAAGGAGCCAGG - Intergenic
925556294 2:5134620-5134642 CAGGGCCCTCAGCAGGAGGAGGG + Intergenic
925824282 2:7832303-7832325 CTGTGTTACCAGAAGGAGCATGG + Intergenic
926725850 2:15997305-15997327 CAGGGCCACCAGCATCAGGAAGG - Intergenic
927213339 2:20651735-20651757 TTGGGTCCCCAGCTGGAGCAGGG + Intergenic
927971306 2:27307599-27307621 CAGGGTCCGCAGCAGGTGAAAGG + Exonic
929314342 2:40459458-40459480 CAGGGTCAGCAGCAGAGGCATGG + Intronic
929776883 2:44935541-44935563 CAGGGTCAGCACCAGCAGCTCGG + Intergenic
930028987 2:47046993-47047015 CAGGGTCTCCAGCAGGAGACAGG - Intronic
930232601 2:48858118-48858140 GGGAGTCACCAGCAGGAGCTGGG + Intergenic
930728933 2:54709359-54709381 CAGAGTGAGCAGCAGGAGCTGGG - Intergenic
933759368 2:85663472-85663494 CAGGGTCGCCGACAGGAGAATGG - Exonic
933893484 2:86790784-86790806 CAAGGCCAGCGGCAGGAGCAAGG + Exonic
935217856 2:100988812-100988834 CAGGGGGACCTGGAGGAGCAGGG - Intronic
935848112 2:107188183-107188205 CATGCTCATCAGCAGCAGCAGGG - Intergenic
936040396 2:109145347-109145369 CAGGGTCATGAGCAGGGCCATGG - Intronic
938286242 2:130120167-130120189 CAGGGGGAGCAGCAAGAGCAAGG - Exonic
938287196 2:130128363-130128385 AAGAGTCACCCGAAGGAGCAAGG + Intronic
938293820 2:130164331-130164353 CAGGGTCAGAAGCAGGAGGTGGG + Intronic
938458830 2:131484585-131484607 CAGCGGCAGCAGCAGCAGCAGGG + Intronic
938462724 2:131508631-131508653 CAGGGTCAGAAGCAGGAGGTGGG - Intergenic
938469300 2:131544509-131544531 AAGAGTCACCCGAAGGAGCAAGG - Intergenic
939635171 2:144573342-144573364 CAGGGTCACCAATAGGAGCTAGG + Intergenic
940048696 2:149437731-149437753 CAGGCTCAGGAGCAGGAGCCAGG - Exonic
940757426 2:157699228-157699250 CTGGGTCAGAAGAAGGAGCAGGG + Intergenic
941681405 2:168403506-168403528 CAGGCTCACCACCAGAGGCAAGG - Intergenic
942057588 2:172199016-172199038 CAGGCACAACAGCAGCAGCAAGG - Intergenic
942231415 2:173863870-173863892 TAGGGTCACCAGCATGGCCAGGG + Intergenic
942613048 2:177761998-177762020 TAGGGTCAACAGCAGGAGGCGGG + Intronic
942990942 2:182201793-182201815 CAGAGTCACCAAAAGGAGAAAGG + Intronic
944709039 2:202319329-202319351 CAGGGTCACCAGCAGCACCATGG + Intergenic
944987010 2:205188673-205188695 CTAGGTGACCAGCAGCAGCAGGG + Intronic
946328257 2:218996092-218996114 CAGTGTCACCAGCCCGGGCAGGG + Intergenic
946385846 2:219384075-219384097 CAGGAAAAGCAGCAGGAGCAAGG + Intronic
947751257 2:232533926-232533948 CAGGGTCTCCAGGAAGAGCTGGG - Exonic
947753253 2:232543593-232543615 GATGGTCACCACCAGGAGGAAGG - Exonic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
948489396 2:238302849-238302871 CAGAGTCCTGAGCAGGAGCAGGG - Intergenic
948584651 2:239011766-239011788 CCAGGTCAGCAGCAGGACCAGGG - Intergenic
1168771573 20:419847-419869 CAGGGTCACTGCCAGCAGCATGG - Intronic
1168771575 20:419865-419887 CAGGGTCACAGCCAGGTGCAGGG - Intronic
1170651320 20:18245270-18245292 CAGGAGAGCCAGCAGGAGCAGGG + Intergenic
1171037353 20:21726340-21726362 CAGAGTCACCACCAGCAGGAAGG - Intergenic
1171225690 20:23440293-23440315 CAGGGCAATCAGCAGCAGCAGGG - Exonic
1171238414 20:23546384-23546406 CAGGGTCAAGAGAAGGACCAAGG + Intergenic
1171243252 20:23588043-23588065 CAGGGTCAAGAGAAGGACCAAGG - Intergenic
1171428720 20:25065212-25065234 CAGAGGCACCGGCAGCAGCAGGG + Intergenic
1172152621 20:32801113-32801135 CAGGGACACAGGCAGCAGCAGGG - Intronic
1172299819 20:33841462-33841484 CAGGCTCACCTGCAGGACAAGGG - Intronic
1172390018 20:34559765-34559787 CTGGTTCACCAGCAGGAAGAAGG - Exonic
1172872593 20:38144940-38144962 CAGGGTGACCAGGATGACCAGGG + Intronic
1173163746 20:40671640-40671662 CAGGGACACCAGGAAGGGCATGG + Intergenic
1174180316 20:48670304-48670326 CAGGGTTCTCAGCAGGGGCAGGG - Intronic
1176113963 20:63423005-63423027 CAGGGCCAGCAGCAGGGGCGGGG + Intronic
1176379195 21:6103349-6103371 CAGAGGCAGCAGCAGGGGCAGGG + Intergenic
1176379201 21:6103367-6103389 CAGGGGCAGCAGCAGGGGCAGGG + Intergenic
1176379221 21:6103421-6103443 CAGGGGCAGCAGCAGGGGCAGGG + Intergenic
1177333606 21:19694704-19694726 CAGGGGCAACAGAAGTAGCATGG + Intergenic
1177624757 21:23645893-23645915 CAGGCACACCAGCTGCAGCAGGG + Intergenic
1179044351 21:37831438-37831460 CTGGGTTACCTGCAGGACCAGGG - Intronic
1179551670 21:42147360-42147382 CACAGACACCAGCAGTAGCAGGG - Intergenic
1179744252 21:43434816-43434838 CAGGGGCAGCAGCAGGGGCAGGG - Intergenic
1179744272 21:43434870-43434892 CAGGGGCAGCAGCAGGGGCAGGG - Intergenic
1179744278 21:43434888-43434910 CAGAGGCAGCAGCAGGGGCAGGG - Intergenic
1179975272 21:44861875-44861897 CATGGTCACCATCTGTAGCAAGG + Intronic
1180183321 21:46127569-46127591 CAGGGTCCACATCAGCAGCAGGG + Intronic
1180469955 22:15644426-15644448 CTCAGTCACCAGCAGGAGGAGGG - Intergenic
1181466444 22:23113083-23113105 CAGGGTCAGCCGCAGGGGCAGGG - Intronic
1181928002 22:26375773-26375795 CAGGGTCTCCACCTGGAGCTCGG + Intronic
1181982505 22:26775466-26775488 GTGGGACATCAGCAGGAGCAAGG + Intergenic
1182254886 22:29031044-29031066 CAGGGGCAGCGGCAGGAGCGGGG - Intronic
1182821711 22:33222309-33222331 GAGGGTTACCAGCATGAGCCTGG + Intronic
1183524175 22:38314050-38314072 CAGGGGCTCCAGCTGGAGCTAGG + Intronic
1183529834 22:38347392-38347414 CAGGGGCATGAGCAGGAGCCTGG + Intronic
1183987395 22:41577081-41577103 CTGGGCCACCAGGTGGAGCATGG + Exonic
1184334904 22:43847454-43847476 CAAGGGCACCACCAGGAGCATGG - Intronic
1184388638 22:44190578-44190600 CAGGGCCACAAGGAGGTGCAGGG - Exonic
1184797707 22:46741428-46741450 CCTGGCCACCAGCAGGAGCCTGG + Intergenic
1185330593 22:50250552-50250574 CAGGGTCACCAGCAGGAGCAGGG + Intronic
1185389124 22:50549353-50549375 CAGGGCCACCAGCTTGAGCTGGG - Exonic
949395641 3:3612138-3612160 CAGGGTCACCAGCACCCACAGGG + Intergenic
949421824 3:3873832-3873854 TAGGGTCAAGGGCAGGAGCAAGG - Intronic
949460303 3:4284526-4284548 CAGGGTCACCTGTAGCAGAATGG - Intronic
950194820 3:11001583-11001605 GAGGCTCACCTGCAGGGGCAGGG + Intronic
950863627 3:16171899-16171921 CAGGTTCCCCAGCAGAGGCAGGG + Intergenic
950868989 3:16212801-16212823 CAGGGCCACTAGCAGGAGGTGGG + Intronic
951891998 3:27576102-27576124 CCTGGTCACCAGAAGGAACAAGG - Intergenic
952646697 3:35668405-35668427 CAGAGACTCCAGCAGGAGCAAGG - Intronic
952919596 3:38275633-38275655 CAGGGTCACCTTCCGGAGCTGGG - Exonic
953695154 3:45152496-45152518 TAAGGTGACCAGAAGGAGCAAGG - Intergenic
953896811 3:46809357-46809379 CAGGGTCACCAGGATGCCCAGGG + Intronic
954870579 3:53764661-53764683 CAGGGGCAGCGGGAGGAGCAGGG - Intronic
955500620 3:59579129-59579151 CAAGGCCACCGGCATGAGCATGG + Intergenic
956253890 3:67263573-67263595 CAGTGCTACCAGCAGGAACATGG - Intergenic
959274227 3:104257355-104257377 CAGAAGAACCAGCAGGAGCAAGG + Intergenic
961745428 3:129061235-129061257 CAGGGACACTGGCTGGAGCAGGG - Intronic
963317111 3:143771710-143771732 GAGGGACAACAGCAGGAGCACGG - Intronic
963338126 3:144000927-144000949 CAGGGTGAGGAGCAGTAGCAAGG + Intronic
963622305 3:147625675-147625697 CAAGGTGACCAGCATAAGCATGG + Intergenic
964060652 3:152518311-152518333 CAGAGTTGCCAGGAGGAGCAGGG - Intergenic
966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG + Exonic
967214029 3:187194921-187194943 CAGCATCCCCAGCAGTAGCAGGG + Intergenic
967681572 3:192370002-192370024 GAGCAGCACCAGCAGGAGCAAGG + Intronic
967955053 3:194871687-194871709 CAGTGTCCTCAGCAGGAGCCCGG - Intergenic
968137244 3:196228227-196228249 CAGGGGCAGCAGCAGCAGCAGGG - Exonic
968276834 3:197446617-197446639 CAGGATCAGCAGCACCAGCATGG + Intergenic
968439111 4:612657-612679 CAGGAAGACCAGCAGGAGCCTGG + Intergenic
968641148 4:1715708-1715730 CAGGGCCCTCTGCAGGAGCAGGG - Intergenic
968933940 4:3600171-3600193 CCTGGTCACCAGCACCAGCAAGG + Intergenic
969234222 4:5853938-5853960 CTGGGTCACCAGCAGGCGAATGG - Intronic
969322930 4:6424027-6424049 CAGGGTCCCCGGCTGGAGGAAGG + Intronic
969587607 4:8103572-8103594 CATGGACTCCAGCAGTAGCAGGG - Intronic
970427986 4:15963094-15963116 CAAGGTCACCAGCAGGAGGCAGG + Exonic
972573472 4:40330998-40331020 CAGGGTGAGCAGCAGGGGAATGG - Intergenic
975409997 4:74038552-74038574 CAGCGCCACCCGCAGGAGCCGGG + Exonic
975415385 4:74099061-74099083 CAGCGCCACCCGCAGGAGCCGGG + Exonic
975612073 4:76213484-76213506 GCTGGTCACCAGCAGGAGCAGGG + Exonic
976974944 4:91154484-91154506 CAGGAGCAGGAGCAGGAGCAGGG - Intronic
982064806 4:151644790-151644812 CAGGGTGCACAGCAGGAACAGGG - Intronic
984313196 4:178090886-178090908 CAGAGCCACCAGCCAGAGCAGGG + Intergenic
984568621 4:181362671-181362693 CAGACTCACCAGCAGGAAAAAGG + Intergenic
985162761 4:187061606-187061628 CTGGCTCACCAGCAGTAGCAAGG - Intergenic
985645654 5:1083596-1083618 CAGGCTCATCAGCAGCAGCTGGG + Intronic
985922959 5:2993908-2993930 CACGGGCACCAGCAGAGGCAAGG - Intergenic
986178992 5:5376121-5376143 GAGGGTAAACAGCAAGAGCAAGG + Intergenic
986275567 5:6272217-6272239 CAGGATCACCAGCTGGGGAAGGG - Intergenic
986284649 5:6350504-6350526 CAAGGACAGCAGCAGCAGCAAGG - Intergenic
986796926 5:11221831-11221853 AAGTGTCACCAGGAGGAGAAAGG + Intronic
987051319 5:14148876-14148898 CTGGGTCCCCAGCTGGAGCAAGG + Intronic
989098894 5:37806553-37806575 CAGGGGCAAAAGCAGAAGCATGG - Intergenic
989247139 5:39266860-39266882 CATGGTCACCAGCCTGAGAATGG + Intronic
989624951 5:43420357-43420379 GAGGGTCACCCACCGGAGCATGG - Intergenic
990050946 5:51500106-51500128 AAAGGTCAGGAGCAGGAGCAAGG - Intergenic
990368545 5:55094121-55094143 GATGGTCACCAGCAGGAGTTAGG + Intergenic
991332824 5:65510940-65510962 CAGAGTCACCAGCAGCAAGAGGG + Intergenic
993307403 5:86289767-86289789 CAGGGCCTACAGCAGGTGCAAGG - Intergenic
994097170 5:95857696-95857718 GAGGGTCAGCATCAGGAGCCTGG + Intronic
995279339 5:110315939-110315961 CAGGGTCAACTGCAGAAACAAGG - Intronic
998430542 5:142066178-142066200 CAGGGGCAGCAGCAGAAGCCAGG + Intergenic
998563284 5:143192331-143192353 CAGCAGCACCAGCAGGAACATGG + Intronic
998920166 5:147059455-147059477 CAGGGTCACCAGGAGAGGAATGG + Intronic
999232186 5:150068239-150068261 CAGGAGCAGCAGCAGCAGCAAGG + Exonic
999887048 5:155935916-155935938 CAGGCACACCAGCTGCAGCAGGG + Intronic
1000464234 5:161555394-161555416 CTGCTTCACCAGCAGGAGTAAGG - Intronic
1002097047 5:176837541-176837563 CAGGGTCACCATCAGGAAATAGG + Intronic
1002197553 5:177509538-177509560 CATGGTCACGGCCAGGAGCAGGG + Exonic
1002334277 5:178467308-178467330 AAGGGTCTCCACCAGGGGCAGGG - Intronic
1002903176 6:1426884-1426906 CATGGTCACCAGGTGGAGCTGGG - Intergenic
1005016273 6:21378107-21378129 CAGTGTCACCTGCTGCAGCAAGG + Intergenic
1005452974 6:25992050-25992072 CGGTGTCCCCAGCTGGAGCAGGG + Intergenic
1005468939 6:26142872-26142894 CAGGGTCACATGCAGGTACAGGG + Intergenic
1005835004 6:29702335-29702357 CAGGAGCAGCAGCAGGAACAAGG + Intergenic
1007070577 6:39035115-39035137 CATGGTAACCAGAAGGAGCATGG + Intergenic
1007335820 6:41154256-41154278 CAGGAGCAGCAGCAAGAGCAGGG + Exonic
1008640549 6:53458139-53458161 CAGTGTCATCAGCTGGAACATGG + Intergenic
1008815494 6:55559558-55559580 CAGGGGCACAAGAAGGAGCGTGG + Intronic
1012258912 6:97065000-97065022 CAGGGTTCCCTGCAGGAGCCGGG + Intronic
1013111649 6:107069448-107069470 CAGGTGCACCAGCAGGCGCGAGG + Exonic
1014040118 6:116816470-116816492 CTGGGACACAAGCAGCAGCAGGG + Intronic
1017072053 6:150584244-150584266 GAGGTTCAGCAGCAGAAGCACGG - Intergenic
1017718772 6:157230485-157230507 CAGGGCCATCAGGAGAAGCAGGG + Intergenic
1017952668 6:159149451-159149473 CAGGCTGACCACCAGAAGCATGG + Intergenic
1017983310 6:159421589-159421611 GAGGGTCTCCAGCAGGACCATGG - Intergenic
1018362104 6:163081327-163081349 CAGGGACTACAGCAGGGGCATGG + Intronic
1018716065 6:166533514-166533536 CAGTGACACCAGCAAGGGCAGGG + Intronic
1018952837 6:168390459-168390481 ACGGGGCACCAGCAGGTGCAGGG - Intergenic
1019315179 7:380844-380866 CACGGTCACCAGCGGGACCTGGG - Intergenic
1019959826 7:4449804-4449826 AGGGGGCAGCAGCAGGAGCAGGG - Intergenic
1022456620 7:30563773-30563795 CAGCGGCTTCAGCAGGAGCATGG - Intergenic
1022778647 7:33554963-33554985 CAAGGTCAGCAGATGGAGCAAGG + Intronic
1022789742 7:33675013-33675035 CAGCGTCACCAGCAGAGGGAAGG + Intergenic
1024921657 7:54563509-54563531 CAGTGTCCCCAGCAGGAGGAAGG + Intronic
1025226223 7:57166586-57166608 CAGGCTCTTCAGCAGGAACATGG + Intergenic
1026575398 7:71567273-71567295 CTGCTACACCAGCAGGAGCAAGG + Intronic
1028753099 7:94404707-94404729 CAGGCTCACCAGCAGGTCCTTGG - Exonic
1031024352 7:116663878-116663900 CAAGGTCACCATCAGGAGGGAGG + Intergenic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1032742218 7:134750203-134750225 CCTGTTCACCAACAGGAGCAAGG + Intronic
1033227218 7:139571574-139571596 CAGGGAAGCCAGCAGGAGCTAGG - Exonic
1033485338 7:141783594-141783616 TAAGGTCAACAGCAGGAGGAGGG + Intronic
1034077424 7:148245633-148245655 CAGGGTCACCATGAGGTTCAAGG + Intronic
1034172237 7:149071513-149071535 CAGGTCCACCAGCACGCGCACGG - Exonic
1034245523 7:149641426-149641448 CAGGGGCAGCAGGAGAAGCAGGG + Intergenic
1034274638 7:149818663-149818685 CAGGGGGACCAGGAGGACCATGG - Intergenic
1034566968 7:151923125-151923147 CAGCGGCACCAGCAGGAGACAGG - Intergenic
1034859201 7:154581708-154581730 CAGTGTCCCCTGCAGGTGCAGGG + Intronic
1035100069 7:156389244-156389266 CAGGGACACCAGCTGGAGGAAGG - Intergenic
1035106624 7:156446525-156446547 CAGAGGCCCCAGCAGGGGCAAGG - Intergenic
1035212037 7:157336167-157336189 GATGGTGACCAGCAGGAGCAGGG - Intronic
1035241856 7:157537415-157537437 CAGAGTCACCAGCTGGGGCTTGG - Intergenic
1036229564 8:6988227-6988249 CAGGGCCACCAGGAGAAGCATGG + Intergenic
1036232015 8:7007330-7007352 CAGGGCCACCAGGAGAAGCATGG + Intronic
1036915344 8:12799120-12799142 CAGGCACACCAGCTGCAGCAGGG + Intergenic
1037326351 8:17694959-17694981 CTTGGTCACCAGCAGAATCAAGG + Intronic
1037618629 8:20543623-20543645 CAGGGACACCCACAGAAGCAAGG - Intergenic
1039558396 8:38493450-38493472 CAGAGTTACCAGCATCAGCATGG + Intergenic
1040487637 8:47888930-47888952 CAGGAGCAGCTGCAGGAGCACGG + Intronic
1040866859 8:52056277-52056299 CCCTCTCACCAGCAGGAGCAAGG - Intergenic
1041362607 8:57068662-57068684 AAGGGGCACCAGAAGGAACAAGG + Intergenic
1042804838 8:72759930-72759952 CAGTGTCACTGGCAGAAGCAAGG + Intronic
1043414685 8:80034436-80034458 CAAGGACACCAGCTGCAGCAAGG - Intronic
1043745480 8:83869206-83869228 CTGGGTCTCCAGCAGCAGCAGGG - Intergenic
1046541595 8:115590514-115590536 CAGGGTGACAAGAAGGAGAAGGG + Intronic
1049179674 8:141215827-141215849 CATGGTCACCATCAGCACCATGG - Exonic
1049319427 8:141988100-141988122 CAGGGTCACAAAAGGGAGCATGG - Intergenic
1049514298 8:143045297-143045319 CAGGGCCACCAGCAGGACCAGGG + Intronic
1049697761 8:143991894-143991916 CAGGGTCACCGACAGCTGCAAGG - Exonic
1049777272 8:144412562-144412584 CAGGGACAGCAGCAGCAGGACGG + Exonic
1051894580 9:21974648-21974670 GAGGGTCTGCAGCGGGAGCAGGG - Intronic
1052666600 9:31502789-31502811 CAGCATCAACAGCAGGAGCAAGG + Intergenic
1053577086 9:39364094-39364116 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1053841592 9:42192019-42192041 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1054098657 9:60922784-60922806 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1054120057 9:61198413-61198435 CAGGATCAGCAGGAGGAGCTGGG + Intergenic
1054456216 9:65431807-65431829 CCTGGTCACCAGCACCAGCAAGG - Intergenic
1054587699 9:66984149-66984171 CAGGATCAGCAGGAGGAGCTGGG - Intergenic
1056751574 9:89355426-89355448 GAGGGTCAGCATCAGGAGCTTGG + Intronic
1057049714 9:91914537-91914559 CAAGGTGACCGGCAGGAGGATGG - Intronic
1057080766 9:92172914-92172936 CAGGGGCACCAGCAGGTGCAAGG - Intergenic
1057836003 9:98445791-98445813 CAGGGGCACCTGCAGCAGCTGGG + Intronic
1057854668 9:98593422-98593444 CAGGGACAATGGCAGGAGCAGGG + Intronic
1060103609 9:120860201-120860223 CCGGGCCACCAGCAGGCTCACGG - Intronic
1061055168 9:128218664-128218686 CAGGGTCACCGGCACCAACAAGG + Exonic
1061137402 9:128742779-128742801 CAGGGTCAGACTCAGGAGCAGGG + Intronic
1061513253 9:131073449-131073471 CAGTGTCACCAGCATGGGGAGGG + Intronic
1061745134 9:132733966-132733988 CAGGGTGCCCACCTGGAGCAGGG - Intronic
1061938859 9:133873441-133873463 CAGTGTCTTCAGCAGGGGCATGG - Intronic
1062048014 9:134433294-134433316 CTGGGGCACCAGCAGGACCTGGG + Intronic
1062481465 9:136754431-136754453 CAGGGTGCCCAGGAGGGGCAGGG + Exonic
1186518803 X:10187511-10187533 CTAGATCACCAGCAAGAGCAAGG + Exonic
1186606463 X:11097963-11097985 AAGGGTTACCAGGATGAGCAAGG + Intergenic
1186683007 X:11895615-11895637 CAATGTTACCAGCAGCAGCAGGG - Intergenic
1187592887 X:20738474-20738496 AAGTGTCAGGAGCAGGAGCAAGG - Intergenic
1188953559 X:36407165-36407187 AAGGGTCACCAGGAAGAGTAGGG - Intergenic
1191768851 X:64733162-64733184 CAGTGTCCCCAGCACCAGCAGGG + Intergenic
1192168763 X:68841721-68841743 CTGGGACAGCAGCAGGAGCTGGG - Exonic
1197035300 X:121866754-121866776 TAGGGACACCAGGAGGATCATGG + Intergenic
1198267318 X:135021913-135021935 CAGGGGCGGCAGCAGGAGCCTGG + Exonic
1198268570 X:135032908-135032930 CAGGGGCGGCAGCAGGAGCCTGG - Exonic
1199097286 X:143758002-143758024 CAGGGGCACCAGCAGTACCTGGG + Intergenic
1199974220 X:152883119-152883141 CAGGGTCAACAGGAGCAGCCAGG + Intergenic
1200116359 X:153771390-153771412 CAGGCTCACCATAAAGAGCATGG - Exonic
1200140657 X:153901240-153901262 CAGGGTCTCCAGCAGGTGCTGGG - Intronic