ID: 1185333370

View in Genome Browser
Species Human (GRCh38)
Location 22:50261374-50261396
Sequence CGGCGCGGTGTGGTGAGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 94}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185333370_1185333377 -3 Left 1185333370 22:50261374-50261396 CCCGCGCTCACCACACCGCGCCG 0: 1
1: 0
2: 1
3: 8
4: 94
Right 1185333377 22:50261394-50261416 CCGTAGGCGCCCGAGCCCACGGG 0: 1
1: 1
2: 1
3: 0
4: 37
1185333370_1185333381 10 Left 1185333370 22:50261374-50261396 CCCGCGCTCACCACACCGCGCCG 0: 1
1: 0
2: 1
3: 8
4: 94
Right 1185333381 22:50261407-50261429 AGCCCACGGGCTGCAGGTCCCGG 0: 1
1: 0
2: 0
3: 28
4: 226
1185333370_1185333375 -4 Left 1185333370 22:50261374-50261396 CCCGCGCTCACCACACCGCGCCG 0: 1
1: 0
2: 1
3: 8
4: 94
Right 1185333375 22:50261393-50261415 GCCGTAGGCGCCCGAGCCCACGG 0: 1
1: 0
2: 0
3: 6
4: 69
1185333370_1185333378 4 Left 1185333370 22:50261374-50261396 CCCGCGCTCACCACACCGCGCCG 0: 1
1: 0
2: 1
3: 8
4: 94
Right 1185333378 22:50261401-50261423 CGCCCGAGCCCACGGGCTGCAGG 0: 1
1: 0
2: 2
3: 14
4: 182
1185333370_1185333384 17 Left 1185333370 22:50261374-50261396 CCCGCGCTCACCACACCGCGCCG 0: 1
1: 0
2: 1
3: 8
4: 94
Right 1185333384 22:50261414-50261436 GGGCTGCAGGTCCCGGTACACGG 0: 1
1: 0
2: 2
3: 4
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185333370 Original CRISPR CGGCGCGGTGTGGTGAGCGC GGG (reversed) Exonic