ID: 1185334164

View in Genome Browser
Species Human (GRCh38)
Location 22:50264091-50264113
Sequence AGGGGCTTTCTCCTTGGATG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185334164_1185334173 12 Left 1185334164 22:50264091-50264113 CCACATCCAAGGAGAAAGCCCCT 0: 1
1: 0
2: 1
3: 18
4: 188
Right 1185334173 22:50264126-50264148 GTGGTTGCCCTTTGGCCCACTGG 0: 1
1: 0
2: 0
3: 5
4: 100
1185334164_1185334172 4 Left 1185334164 22:50264091-50264113 CCACATCCAAGGAGAAAGCCCCT 0: 1
1: 0
2: 1
3: 18
4: 188
Right 1185334172 22:50264118-50264140 ATGCTCATGTGGTTGCCCTTTGG 0: 1
1: 0
2: 0
3: 13
4: 96
1185334164_1185334166 -7 Left 1185334164 22:50264091-50264113 CCACATCCAAGGAGAAAGCCCCT 0: 1
1: 0
2: 1
3: 18
4: 188
Right 1185334166 22:50264107-50264129 AGCCCCTGCCCATGCTCATGTGG 0: 1
1: 0
2: 3
3: 29
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185334164 Original CRISPR AGGGGCTTTCTCCTTGGATG TGG (reversed) Exonic
900089440 1:913471-913493 AGGGGCTGTCTCCTTGGTTTGGG - Intergenic
900096853 1:943260-943282 AGGGGGACTCTCCATGGATGGGG + Exonic
902551540 1:17222514-17222536 TGGGGCTCTTACCTTGGATGGGG - Intronic
903543514 1:24109872-24109894 AGGGCCTTTCTCCTTATAAGGGG + Intronic
904405952 1:30288034-30288056 AGGGGCTTTTTTCCTGGTTGTGG + Intergenic
906933707 1:50193679-50193701 AGGGGCTGTCATCTTGGTTGTGG + Intronic
907302335 1:53496137-53496159 TGGGGCCTTCTCCCAGGATGGGG + Intergenic
907938984 1:59068798-59068820 AGGGGCTTTCACCTTGTGTTGGG + Intergenic
908155297 1:61346907-61346929 AGGGGCTTCCCCCTTTGCTGGGG - Intronic
910047168 1:82931902-82931924 AAGGGATTTCTTCTAGGATGAGG - Intergenic
910566450 1:88648809-88648831 ATGGGCCATCTCCGTGGATGTGG + Intergenic
913995956 1:143652159-143652181 AAGGGGGTTCTCCCTGGATGAGG - Intergenic
914267047 1:146047077-146047099 AGGAGCATTCTCTTAGGATGTGG + Intergenic
914345832 1:146797976-146797998 AGGGACTCTCTGCTTGGGTGAGG - Intergenic
915342554 1:155184464-155184486 AGGGGCTCTCTCCATGGCTTGGG - Exonic
918380057 1:183944902-183944924 AGGGACTTTCTTTTTGGTTGTGG + Intronic
918811212 1:189123370-189123392 AAGGGGTTCCTCCTTGGATCTGG - Intergenic
920883404 1:209900829-209900851 AGGGGCTGTAGCCTTGGGTGAGG - Intergenic
1063956965 10:11276190-11276212 AGGGGGCTTCTCCCTGGGTGTGG + Intronic
1065147675 10:22787614-22787636 ATTGGCTTACTCCTTGGAAGAGG + Intergenic
1069335755 10:67348301-67348323 AGAAGCTTTCTCCTTTGATGTGG - Intronic
1069610552 10:69769734-69769756 TGGGGCTTTTTCCTTGCAGGGGG - Intergenic
1073107209 10:101039084-101039106 AGGGCCTATCTCCAAGGATGGGG + Intronic
1073435230 10:103512280-103512302 AGGGGCTTTCTCTTGGGAGTGGG + Intronic
1074078457 10:110150216-110150238 AGGGCCTTTCTCTCTGGGTGTGG + Intergenic
1075037295 10:119080343-119080365 AGGGGCTGTCTCCCGGGCTGCGG + Intronic
1075341019 10:121646848-121646870 AGGGGTTTTCTCTGGGGATGAGG + Intergenic
1075990633 10:126836013-126836035 AGTGGCTTTCTCCTGGATTGTGG + Intergenic
1076473681 10:130737652-130737674 TGGGGCCTTCTCCTTGGCAGTGG - Intergenic
1076978574 11:193320-193342 CTGGGCTTTGTCCTTGGTTGGGG - Intronic
1080313767 11:30925243-30925265 AGGGGATTCTTTCTTGGATGGGG + Intronic
1082901484 11:58258026-58258048 ATGGGATTCCTTCTTGGATGAGG - Intergenic
1083470770 11:62882234-62882256 GGGGGCTTTCTACTTGGCTGTGG + Intronic
1084205192 11:67587059-67587081 AGGGTCATTCTGCTTGGATGGGG + Intergenic
1088314569 11:108494972-108494994 AGGGTCTTTGTCCTTGGGTGGGG - Intronic
1090397645 11:126429724-126429746 GGGGCGTTTCTCTTTGGATGGGG - Intronic
1090521848 11:127488385-127488407 AAGGGCTTTGCTCTTGGATGAGG - Intergenic
1091693079 12:2610318-2610340 AGGGGCTCTCTCCTTGATTAAGG + Intronic
1093653564 12:21671357-21671379 AAGGGCTTTCTCCTTAGATTGGG - Intronic
1097558290 12:61167453-61167475 AGGGTCTTCCCCCTTTGATGGGG - Intergenic
1102236140 12:111295878-111295900 AGTGGCTGTCTCTTTAGATGAGG - Intronic
1103733931 12:123046548-123046570 ATGGGCTTTCTTTTTGGGTGAGG - Intronic
1103905456 12:124325294-124325316 AGGGGCTCCTTCCTTGGTTGGGG + Exonic
1104383429 12:128328067-128328089 CTGGGCTTTCTCCTTGGCTAGGG - Intronic
1105567429 13:21564454-21564476 AGGGGCCTGCTCTATGGATGTGG + Intronic
1112240705 13:97678731-97678753 AGTGGCTGTTGCCTTGGATGGGG - Intergenic
1115193625 14:30773286-30773308 AGCAGCTTTCTCATTAGATGAGG + Intergenic
1118790791 14:69090626-69090648 AGGATTTTTCTCCTTAGATGGGG - Intronic
1120859478 14:89241902-89241924 AGGGGCTTTCTCCATGGGTGGGG - Intronic
1121579920 14:95021921-95021943 TGTGGCTTTCATCTTGGATGTGG + Intergenic
1122788148 14:104173371-104173393 GGCGGCTTTCTACCTGGATGCGG + Exonic
1125356924 15:38826057-38826079 AGGGTCTCTCTCCTTGGTTGTGG + Intergenic
1125855048 15:42940374-42940396 AAGGGCTTTGTTCCTGGATGCGG + Intergenic
1127295842 15:57607916-57607938 AGGGGCCACTTCCTTGGATGTGG + Intronic
1127499751 15:59544905-59544927 CAGGGCCTTCTCCTTGGTTGGGG + Intergenic
1127626931 15:60788793-60788815 AGGGGCTTTCTCATGGAAGGGGG - Intronic
1128909477 15:71499276-71499298 AGAGGCTTCCTCCTTGGCCGTGG - Intronic
1128914449 15:71547031-71547053 AGGGGCTGTCCCCCTGCATGTGG + Intronic
1130486827 15:84402786-84402808 TGGGGCCTTCTCAATGGATGTGG - Intergenic
1132315851 15:100889894-100889916 AGGGGCGCTCTCCTGTGATGTGG - Intronic
1133429283 16:5722658-5722680 AGGTGGTTTCACCTTGGTTGAGG + Intergenic
1136566303 16:31072859-31072881 AGGGGCTTTCCCGTTGGAGAAGG - Intronic
1139860540 16:70017029-70017051 GGGGGTTCTATCCTTGGATGAGG - Intergenic
1139988151 16:70917291-70917313 AGGGACTCTCTGCTTGGGTGAGG + Intronic
1142023310 16:87797858-87797880 AGAGGTTTTCTTATTGGATGTGG - Intergenic
1142466005 17:137811-137833 CTGGGCTTTGTCCTTGGTTGGGG - Intronic
1142571305 17:876519-876541 AGGTGCTTTCTTCATTGATGGGG - Intronic
1143424981 17:6828590-6828612 AGCAGCTTCCTCCTTAGATGGGG + Intronic
1143923940 17:10352713-10352735 TGGGCCTTTCTCAGTGGATGGGG + Intronic
1146521857 17:33531691-33531713 AGGGCCTCTCTCCTTGGCAGTGG - Intronic
1147452039 17:40511835-40511857 AGGAGCATCCTCCTGGGATGGGG - Intergenic
1148839707 17:50487243-50487265 AGGGGCATTTTCCTGGGAAGAGG + Intergenic
1150213095 17:63452275-63452297 AGCGACTTTCCCCTTTGATGGGG - Intergenic
1152571064 17:81121512-81121534 TGGGGCTCCCTCCTGGGATGGGG + Exonic
1153407418 18:4756796-4756818 AGGGGTGCTCTCCTTGGATCTGG - Intergenic
1156339327 18:36197104-36197126 AGGGCCTTCCTCCTTGAAAGTGG + Intronic
1157720101 18:49916952-49916974 AGGGGCTTTCTGATTTGGTGGGG + Intronic
1157797715 18:50590364-50590386 AGTGACTTTCTCCTTGGAGGAGG + Intronic
1159089276 18:63829133-63829155 AATGGCTTTCACGTTGGATGAGG + Intergenic
1159879071 18:73840808-73840830 AGAGGCTCTCTCCTTGGAACAGG - Intergenic
1159950044 18:74476308-74476330 AGCGGGTTTTTGCTTGGATGGGG - Intergenic
1165831258 19:38731516-38731538 TGGGGCTTTCTCCTTGCCAGTGG + Exonic
1166993336 19:46706183-46706205 AGCTGATTTCTCCATGGATGAGG - Intronic
1167262163 19:48464839-48464861 TGGGGCTCTCTCCTGGGATGGGG + Exonic
1167675167 19:50879450-50879472 GGGGCCTTTCCCTTTGGATGGGG + Exonic
1168356467 19:55703257-55703279 AGCAGCTATCTCCTTGGTTGAGG - Intronic
929825167 2:45304441-45304463 AGGTGCTCTCTCTTTGGGTGGGG - Intergenic
929997136 2:46835737-46835759 TGGGCCATCCTCCTTGGATGTGG - Intronic
932004190 2:67911567-67911589 AGCCGCTTTCTCCTTGGAGGAGG - Intergenic
932490458 2:72116574-72116596 TGGGGCTTTCTCCCAGAATGGGG - Intergenic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
935991059 2:108719525-108719547 AGGCGCTTTCCTCTTGGAAGTGG + Exonic
937824050 2:126345365-126345387 AGGGGGTTTCTTGTTAGATGTGG + Intergenic
937850102 2:126624298-126624320 ATGGGCTTTCTCCTTGGCCAGGG - Intergenic
938256361 2:129862711-129862733 AGGGGCTTCCCTCTTGGAGGTGG + Intergenic
944743250 2:202632923-202632945 TGGGGCTTTCTCTGTGGAGGGGG + Intergenic
948673330 2:239582600-239582622 TGGGGCTTCCTGCTTGAATGGGG - Intronic
948845079 2:240679240-240679262 CTGGGCTGTCTCCTGGGATGTGG - Intronic
948848781 2:240695639-240695661 CTGGGCTGTCTCCTGGGATGTGG + Intronic
1169027213 20:2381192-2381214 AGGCGCTGTCTCCTGGGCTGGGG + Intronic
1169988485 20:11473349-11473371 ATAGGCTTTCCCCTTGGCTGAGG - Intergenic
1170154689 20:13258598-13258620 AGAGGCTTTCTTTTGGGATGTGG - Intronic
1172325567 20:34031865-34031887 AGCTGCTTTCTGCTGGGATGTGG + Intronic
1173115254 20:40235781-40235803 GAGGGCATTGTCCTTGGATGTGG - Intergenic
1173231592 20:41203054-41203076 AGGGGCTCTCTCCTTGTATTTGG + Exonic
1173854378 20:46240740-46240762 GGGGGCTGTGTCCATGGATGTGG + Intronic
1173980566 20:47220622-47220644 ATGTACTTTCTCCTTGGATATGG - Intronic
1174419397 20:50389885-50389907 GGGGGCTTCTTCCTGGGATGGGG - Intergenic
1174949047 20:55023489-55023511 AGAGCCTTTCTCCTTTGAGGAGG - Intergenic
1174976744 20:55344424-55344446 AGGCGCTTTCTCCTGGGGCGGGG + Intergenic
1175749506 20:61485522-61485544 TGGAGCTCTCTCCTTGGCTGGGG - Intronic
1176623917 21:9075412-9075434 AGAGGCCTTCTCCTTGGCTTAGG - Intergenic
1180181429 21:46120248-46120270 AGGGGCTTCCTCCCAGGAAGTGG + Intronic
1180918783 22:19507556-19507578 AGGGGCTTTTCCCTTGGGGGTGG - Intronic
1181100841 22:20537699-20537721 GTGGGCTTTCTCCCTGGGTGGGG + Intronic
1181671237 22:24426496-24426518 AGGGGCTTGGTCCTAGGAGGTGG + Intronic
1181672621 22:24432789-24432811 AGGGGCTGCCTCCTTGGGAGGGG + Intronic
1185334164 22:50264091-50264113 AGGGGCTTTCTCCTTGGATGTGG - Exonic
953921656 3:46956045-46956067 AGGGGCTTTCTGATTGCATCAGG + Intronic
954848084 3:53577375-53577397 TTTGGCTTTCTCCTAGGATGTGG + Intronic
956223790 3:66933503-66933525 AGAGGCTTTCTCCCTGGAGTGGG + Intergenic
963806500 3:149728220-149728242 AGGGGCTTTGTTCTGGAATGTGG + Intronic
964172182 3:153783834-153783856 AGGAACTTACTCCTAGGATGTGG + Intergenic
969515742 4:7647281-7647303 GGGTGCTTTCTCCATGCATGTGG + Intronic
970006133 4:11412614-11412636 AGAGGCTGTTTCCTTGGATAGGG + Intronic
970827122 4:20289507-20289529 ATGGGTTTTTTTCTTGGATGAGG - Intronic
971433100 4:26589533-26589555 ATGTGCTTTATCCTTGGATGTGG + Intronic
972934541 4:44116577-44116599 AAGTGCTTTCTCATTTGATGTGG + Intergenic
973592629 4:52458262-52458284 AGGGGCGTCCTCCATTGATGAGG - Intergenic
973755363 4:54068410-54068432 AGGGGCTTCGTCCTTGTATATGG - Intronic
976019171 4:80599076-80599098 AAAGACTTTCTCCTTGGATTTGG - Intronic
976235139 4:82889119-82889141 AGTTGCTTTCTCCTTTGATTTGG - Intronic
976947104 4:90783647-90783669 AAGTGTTTTCTCCTTGGAAGAGG - Intronic
977095230 4:92733994-92734016 ATGGAGCTTCTCCTTGGATGTGG - Intronic
981354917 4:143777936-143777958 AGTGTCTTTCTCCTTGAATACGG - Intergenic
982094787 4:151912007-151912029 GAGAGTTTTCTCCTTGGATGGGG + Intergenic
983990806 4:174117570-174117592 ACTGCCTTTCTCCCTGGATGCGG + Intergenic
990675445 5:58179087-58179109 AGGAGCTTTCTCTTTGGAGGAGG - Intergenic
993885299 5:93408955-93408977 GGGGACTTTCTCCTAGGATATGG + Intergenic
995374556 5:111459354-111459376 AAGGGCTATCTCCTTGGTTTGGG + Intronic
995375091 5:111464970-111464992 AGGGGCTGTCTCCTTGGTTTGGG - Intronic
995534689 5:113123241-113123263 AGGGGCTTCCTTCTTGAAGGAGG + Intronic
997384582 5:133462665-133462687 ATAGTCTTTTTCCTTGGATGTGG + Intronic
997434708 5:133865944-133865966 AGGGACATTCTCATTGGATTAGG - Intergenic
998446764 5:142204757-142204779 AGGGGCTTTCTCCATTGAGAAGG + Intergenic
998449536 5:142223424-142223446 AGGTGCTTTGTCGGTGGATGAGG - Intergenic
1001023393 5:168203258-168203280 AAGGGCTTTCTCCTAGTAAGTGG + Intronic
1001247281 5:170114263-170114285 AGGGGTTTTCTCCTAGCATCTGG - Intergenic
1001525431 5:172425402-172425424 AGGGGCTGGCTACTTGGATAAGG + Intronic
1001556016 5:172637729-172637751 AGAACCTATCTCCTTGGATGTGG + Intergenic
1002080222 5:176733225-176733247 AGGGGGATTGTCCTGGGATGGGG + Intergenic
1006414934 6:33897939-33897961 AGGGGCTATCTCCTAGGGAGTGG - Intergenic
1007134599 6:39508659-39508681 AGGGGCTTCCGCCATTGATGAGG + Intronic
1007172338 6:39872600-39872622 AGTAGCTTTCTATTTGGATGGGG - Intronic
1007202619 6:40122906-40122928 AGTGGCTTTCTACTTGCAGGAGG - Intergenic
1007336577 6:41159041-41159063 AGGGGATTTCTCCTTCCAAGAGG + Exonic
1007730266 6:43941266-43941288 AGGGCCCTTCTCCTGGGATCTGG + Intergenic
1008693087 6:54002745-54002767 AGGGGCTTTATCTTTTAATGTGG + Intronic
1013516057 6:110886953-110886975 ACGGGCTTTCTCATTGCATTTGG + Intronic
1014628562 6:123760841-123760863 AGGGGCTTTCCCCTTCACTGGGG - Intergenic
1015515570 6:134079683-134079705 ATGGGCTTTCCACTTGGCTGGGG - Intergenic
1015516647 6:134088838-134088860 ACAGGCTTTCTCTCTGGATGTGG + Intergenic
1017787599 6:157769434-157769456 AGGGGATTTCTCCTGGTCTGCGG + Intronic
1018350173 6:162949903-162949925 TGGGCCTCTCTCCTAGGATGTGG + Intronic
1018959278 6:168435485-168435507 AAGGGCTTTCTCCTTTGGTCTGG + Intergenic
1019336497 7:485328-485350 ATGGGCTTTCTCCTGGGACAGGG - Intergenic
1021914652 7:25419347-25419369 AGAGGCTTTCTCCATGACTGTGG + Intergenic
1022537846 7:31108983-31109005 AGGGGGCTGCTCCTTGGATCTGG - Exonic
1027701798 7:81478883-81478905 AGGGGCTTTTTCCATTGCTGAGG + Intergenic
1028720292 7:94022783-94022805 AGGGGCTTTCCCCTTCTCTGGGG + Intergenic
1028964062 7:96781935-96781957 AGTGGCTTTCTGCAAGGATGTGG - Intergenic
1030719898 7:112858115-112858137 AATGGCTTACTCCTTGGATGTGG + Intronic
1031985964 7:128164957-128164979 AGGGCCTCTCTCCTTGGACCTGG + Intergenic
1033280216 7:140001125-140001147 GGGGGCTTCCTCATTGGGTGTGG + Intronic
1034421133 7:150991544-150991566 AGTGGCTTTGTTCTTGGCTGAGG + Intronic
1034938306 7:155213901-155213923 AGGCGCTTTCTCCTGGGAGGTGG + Intergenic
1035706540 8:1679623-1679645 AGGGGCTGTCCCCTTCCATGTGG - Intronic
1037339234 8:17825052-17825074 AGGGACATTTTCATTGGATGTGG - Intergenic
1038919700 8:32069085-32069107 AGGTGCTATCTCCTTGAAGGAGG + Intronic
1039790482 8:40872073-40872095 AGGGAGTTTCTGCTTGGAAGTGG + Intronic
1044858961 8:96502997-96503019 AGGGGCTTTCTTCTTGTCTTGGG + Intronic
1047826742 8:128584489-128584511 AGGGGCTTTCTCCTTTTATTGGG + Intergenic
1048875459 8:138833781-138833803 AGGGGCTTTGGACTTGGGTGAGG + Intronic
1049250593 8:141586837-141586859 AGGTGCTTCCTCTTTGGCTGTGG - Intergenic
1051664134 9:19452316-19452338 TGGGGTTTTCACCTTGGATCTGG - Intergenic
1052198852 9:25752751-25752773 AGGAACTTTCTTCATGGATGAGG + Intergenic
1052861735 9:33441896-33441918 AGGGGCTGTCTCGTGGGGTGAGG + Exonic
1055771911 9:79726166-79726188 ATGGACTCTCTCCTGGGATGAGG + Intronic
1055839905 9:80491043-80491065 AATAGCTTTCTCCTTTGATGTGG + Intergenic
1055894816 9:81162729-81162751 AGGGGCGTCCTCCATGGCTGAGG + Intergenic
1057777409 9:98022102-98022124 CAGGCCTTTCTCCTTGGCTGGGG + Intergenic
1058878723 9:109267766-109267788 AGGGTTTTTCTCCTGGAATGAGG - Intronic
1059325854 9:113503677-113503699 GGGGGCTTTGGCCCTGGATGGGG + Intronic
1062389602 9:136328623-136328645 AGAGGCTTGCTGCTTGGCTGGGG - Intronic
1203747102 Un_GL000218v1:45840-45862 AGAGGCCTTCTCCTTGGCTTAGG - Intergenic
1189974049 X:46444988-46445010 AGGGGCTGAATCTTTGGATGGGG - Intergenic
1190428173 X:50352110-50352132 AGGAGCTTTCTCCTTGGACTGGG - Intergenic
1192085320 X:68090633-68090655 ATGGGCTTTTTTCCTGGATGAGG + Intronic
1192633052 X:72791712-72791734 AGGGGCTCTCTCCAAGGTTGAGG + Intronic
1192648657 X:72929089-72929111 AGGGGCTCTCTCCAAGGTTGAGG - Intronic
1198274879 X:135090810-135090832 TGGGGCCTTCTCCTTGGACATGG - Intergenic
1198308813 X:135409118-135409140 AGGGGCTTTCTGCTAGGGGGTGG + Intergenic
1199565262 X:149208986-149209008 GGGGTCTTTCTCCTGGGCTGAGG + Intergenic
1201160421 Y:11160835-11160857 AGAGGCCTTCTCCTTGGCTTAGG - Intergenic
1202369357 Y:24186657-24186679 TGGGGCCTTCTCAATGGATGTGG - Intergenic
1202369362 Y:24186677-24186699 TGGGGCCTTCTCAATGGATGTGG - Intergenic
1202501423 Y:25483440-25483462 TGGGGCCTTCTCAATGGATGTGG + Intergenic
1202501428 Y:25483460-25483482 TGGGGCCTTCTCAATGGATGTGG + Intergenic