ID: 1185336163

View in Genome Browser
Species Human (GRCh38)
Location 22:50271734-50271756
Sequence CAGCTAAAGGAGGAGGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185336155_1185336163 21 Left 1185336155 22:50271690-50271712 CCGGCCGAGGCGGGCCGAGGTTT No data
Right 1185336163 22:50271734-50271756 CAGCTAAAGGAGGAGGAGGCCGG No data
1185336157_1185336163 7 Left 1185336157 22:50271704-50271726 CCGAGGTTTTGTGCAGAGTTAAT No data
Right 1185336163 22:50271734-50271756 CAGCTAAAGGAGGAGGAGGCCGG No data
1185336156_1185336163 17 Left 1185336156 22:50271694-50271716 CCGAGGCGGGCCGAGGTTTTGTG No data
Right 1185336163 22:50271734-50271756 CAGCTAAAGGAGGAGGAGGCCGG No data
1185336154_1185336163 22 Left 1185336154 22:50271689-50271711 CCCGGCCGAGGCGGGCCGAGGTT No data
Right 1185336163 22:50271734-50271756 CAGCTAAAGGAGGAGGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185336163 Original CRISPR CAGCTAAAGGAGGAGGAGGC CGG Intergenic
No off target data available for this crispr