ID: 1185336284

View in Genome Browser
Species Human (GRCh38)
Location 22:50272092-50272114
Sequence CGGGAACCCCCTGCCTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185336276_1185336284 4 Left 1185336276 22:50272065-50272087 CCCTCTCATCACTGAGCTGACCT No data
Right 1185336284 22:50272092-50272114 CGGGAACCCCCTGCCTGCCCAGG No data
1185336277_1185336284 3 Left 1185336277 22:50272066-50272088 CCTCTCATCACTGAGCTGACCTG No data
Right 1185336284 22:50272092-50272114 CGGGAACCCCCTGCCTGCCCAGG No data
1185336275_1185336284 5 Left 1185336275 22:50272064-50272086 CCCCTCTCATCACTGAGCTGACC No data
Right 1185336284 22:50272092-50272114 CGGGAACCCCCTGCCTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185336284 Original CRISPR CGGGAACCCCCTGCCTGCCC AGG Intergenic
No off target data available for this crispr