ID: 1185337810

View in Genome Browser
Species Human (GRCh38)
Location 22:50278551-50278573
Sequence GCGAGAACTGGGCACCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185337810_1185337823 15 Left 1185337810 22:50278551-50278573 CCCCCAGGGTGCCCAGTTCTCGC 0: 1
1: 0
2: 1
3: 11
4: 148
Right 1185337823 22:50278589-50278611 CGCTCACATTGTAGTGCATAAGG 0: 1
1: 0
2: 0
3: 2
4: 37
1185337810_1185337824 16 Left 1185337810 22:50278551-50278573 CCCCCAGGGTGCCCAGTTCTCGC 0: 1
1: 0
2: 1
3: 11
4: 148
Right 1185337824 22:50278590-50278612 GCTCACATTGTAGTGCATAAGGG 0: 1
1: 0
2: 0
3: 4
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185337810 Original CRISPR GCGAGAACTGGGCACCCTGG GGG (reversed) Intronic