ID: 1185338277

View in Genome Browser
Species Human (GRCh38)
Location 22:50280431-50280453
Sequence CGGGGCGGCCGCAGGGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 653
Summary {0: 1, 1: 0, 2: 5, 3: 82, 4: 565}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185338277_1185338285 -4 Left 1185338277 22:50280431-50280453 CCAGAGCCCCTGCGGCCGCCCCG 0: 1
1: 0
2: 5
3: 82
4: 565
Right 1185338285 22:50280450-50280472 CCCGCCCGTGGCCCCGCTCGTGG 0: 1
1: 0
2: 1
3: 22
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185338277 Original CRISPR CGGGGCGGCCGCAGGGGCTC TGG (reversed) Intronic
900118709 1:1039599-1039621 ATGGGCTGCCGCAGGGGCTCTGG + Intronic
900151466 1:1180941-1180963 AGGGGCGGGCGCAGGGGCAGGGG - Intronic
900190030 1:1349356-1349378 CGGCGCGGCCCGAGGGGCGCAGG - Intergenic
900252201 1:1676770-1676792 TGGGGCCGCAGCAGGGACTCCGG + Exonic
900262611 1:1739628-1739650 TGGGGCCGCAGCAGGGACTCCGG + Exonic
900283917 1:1890505-1890527 CGTGGCGGCGGCCGGGGCCCCGG - Intronic
900349750 1:2228695-2228717 CGGGGCGGCGGCGGGGGCCGGGG + Exonic
900376248 1:2356090-2356112 AGGGGCGGCAGGTGGGGCTCAGG + Intronic
900393689 1:2444480-2444502 CAGGGCCGCCCCAGGGCCTCCGG - Intronic
900479046 1:2889499-2889521 CAGGTAGGCCGCTGGGGCTCAGG + Intergenic
900565941 1:3331869-3331891 CCGGGGGGCCTCAGGGACTCCGG + Intronic
901221976 1:7588383-7588405 GGGGATGGCCCCAGGGGCTCAGG + Intronic
901833024 1:11905629-11905651 GGGGCCGGGCGCAGTGGCTCAGG - Intergenic
902731838 1:18374821-18374843 CAGGGCAGCCCCAGGGCCTCAGG + Intronic
902856525 1:19210206-19210228 AGAGGCGGCGGCAGCGGCTCCGG - Exonic
902916698 1:19644135-19644157 CGCCGCGGCGGCAGGGGCCCCGG - Intronic
903270144 1:22183051-22183073 CTGGGCGGCAGCAGGGGCAGTGG + Intergenic
903651253 1:24923592-24923614 CGGGGTGGCAGCAGGGCCTCAGG + Intronic
903750045 1:25616257-25616279 CGGGGCAGCCGCCAGGGCGCGGG + Intergenic
903828834 1:26162858-26162880 CGGGCCGGGCGCGGTGGCTCAGG + Intergenic
903883802 1:26529880-26529902 CGGGGCCGCCGGAGGAGCGCGGG + Intronic
903891468 1:26573106-26573128 AGGGGCTGCCGCAAGGGTTCAGG + Intronic
903963299 1:27070793-27070815 ATGGGCGGACGCAGGGGCTTTGG - Intergenic
904207214 1:28863163-28863185 CTGGGCGGCCGCAGGGCTTGCGG - Exonic
905044485 1:34985165-34985187 CGGGCGGGCGGCAGGGGATCGGG - Intronic
905819755 1:40980092-40980114 CGGGGCGGCTTCAGAGGCTGCGG + Intronic
905887939 1:41501764-41501786 CGGGGCGGGCGCTGGTGCTGGGG + Intergenic
907249465 1:53128595-53128617 CAGGGCCTCCGCAGGGGCCCTGG - Intronic
907323505 1:53620377-53620399 CGGGGGGGCCACCTGGGCTCAGG + Intronic
907689143 1:56645245-56645267 CGGGGCGGGCGCGGGGTCCCGGG - Intronic
908128316 1:61051034-61051056 CACGGCGGCCGCAGCGACTCCGG - Intronic
912481532 1:109985184-109985206 CTGGGTGGCGGCGGGGGCTCGGG + Intronic
914255339 1:145957799-145957821 CGGGGGGCCCGCAGGGGGTGTGG + Exonic
914757556 1:150572589-150572611 CGGGTCGGGCGCTGTGGCTCAGG - Intergenic
914917778 1:151829040-151829062 CGGGGTGGCCTCAGGAACTCAGG - Intronic
915520589 1:156440105-156440127 AGGGGCGGGCCCCGGGGCTCTGG + Intergenic
915728090 1:158033050-158033072 CCGGCCGGGCGCAGTGGCTCAGG - Intronic
916484162 1:165243353-165243375 GGGGGCGGAGGCAGGGGCTTGGG - Intronic
917777055 1:178349078-178349100 CGGGCCGGGCGCGGTGGCTCAGG - Intronic
918068739 1:181119577-181119599 CAGGGTGGCTGCAGGGGATCTGG + Intergenic
919463239 1:197902935-197902957 CGGGGCGGCCGCGGCGGGGCGGG - Intronic
922116377 1:222618046-222618068 CGGGGCGGGCGCAGAGGGGCGGG - Intergenic
922204427 1:223434161-223434183 GGGGCCGGGCGCAGTGGCTCAGG + Intergenic
922315064 1:224434634-224434656 CGGGGCGGCTGCGGGGGCGCGGG + Intronic
1064063235 10:12157780-12157802 CCGGCCGGGCACAGGGGCTCAGG - Intronic
1065099804 10:22321528-22321550 CGTGGCGGCCGCGGCTGCTCGGG + Exonic
1065113115 10:22459248-22459270 CGGGGCGGTTGCAGTGGCTCAGG + Intergenic
1065520539 10:26567183-26567205 GGGGGCGGCGGCGGGAGCTCAGG - Exonic
1065523472 10:26594165-26594187 GGGGGCGGCAGCAGGAGCTCTGG - Intergenic
1065549987 10:26860615-26860637 TGGGGCTGCGGTAGGGGCTCGGG + Intronic
1065636981 10:27743438-27743460 CGGCGCGGCCGCAGAGCCTCGGG + Exonic
1066464517 10:35640831-35640853 CGCGGCGGCGGCAGGGGCGGTGG - Exonic
1067071933 10:43138627-43138649 CGGTGCGGGCGCCGGGGCTGCGG + Intronic
1067474455 10:46556687-46556709 CGGGGCGGCGGGAGGGGCGGCGG + Intergenic
1067569484 10:47360862-47360884 TGGGCCGGGCGCAGTGGCTCAGG + Intergenic
1067713804 10:48671679-48671701 AGCGGAGGCCGCAGGGGCTCGGG + Intergenic
1067831116 10:49611538-49611560 CTCGGCGGCTGCACGGGCTCGGG + Exonic
1069651507 10:70053110-70053132 GGGTGCGCCCGCAGGGGCTCGGG - Intronic
1069703342 10:70441712-70441734 CGGGGCGGCTGCTGAGGCCCAGG - Intronic
1071579606 10:86756963-86756985 CGGGGAGGCCAGAGGGGCTCGGG + Intronic
1072591517 10:96832420-96832442 CGGGGCGGCCGGAGGGGCGGCGG - Intronic
1073110705 10:101061626-101061648 GGGGGAGGCGGCAGGAGCTCTGG - Intergenic
1073293387 10:102424322-102424344 TCGGGCCGCTGCAGGGGCTCTGG + Exonic
1073503991 10:103967568-103967590 CGGGGCGGCGACCCGGGCTCCGG - Exonic
1074095114 10:110304766-110304788 CGGGGCGGCGGGAAGGGGTCGGG + Exonic
1074165815 10:110872512-110872534 CGGGGCCGAGGCCGGGGCTCCGG - Intronic
1074814505 10:117134311-117134333 CGGGGCGGCGGCGGCGGCTGCGG + Exonic
1075263091 10:120979785-120979807 CGCGGCGGCAGCAGGGACGCGGG - Intergenic
1075616134 10:123891866-123891888 CGGGGCGGGCGCAGGGGGGCCGG + Intronic
1075728679 10:124623523-124623545 CGTGGCGGGCGAAGGGGCTCTGG + Exonic
1075999825 10:126905684-126905706 CGGGGCGGCGGCGCGGGCGCGGG - Intronic
1076189062 10:128470156-128470178 AGAGGAGGCCGCAGAGGCTCAGG + Intergenic
1076630187 10:131847640-131847662 GGAGGCGGCCTCAGCGGCTCTGG - Intergenic
1076797192 10:132804048-132804070 CTGAGCGGCCCCAGGGCCTCAGG + Intergenic
1076916007 10:133423453-133423475 CGGGGCGGCAGCCGGGGCGGCGG - Exonic
1076948184 10:133665618-133665640 CTGGGCGGCTGCAGGGGCCCGGG - Intergenic
1076949173 10:133668928-133668950 CTGGGCGGCTGCAGGGGCCCGGG - Intronic
1076950157 10:133672227-133672249 CTGGGCGGCTGCAGGGGCCCGGG - Intergenic
1076951142 10:133675526-133675548 CTGGGCGGCTGCAGGGGCCCGGG - Intergenic
1076952132 10:133678836-133678858 CTGGGCGGCTGCAGGGGCCCGGG - Intergenic
1076953120 10:133682146-133682168 CTGGGCGGCTGCAGGGGCCCGGG - Intergenic
1076954104 10:133685445-133685467 CTGGGCGGCTGCAGGGGCCCGGG - Intergenic
1076955088 10:133741797-133741819 CTGGGCGGCTGCAGGGGCCCGGG - Intergenic
1076956078 10:133745107-133745129 CTGGGCGGCTGCAGGGGCCCGGG - Intergenic
1076957067 10:133748417-133748439 CTGGGCGGCTGCAGGGGCCCGGG - Intergenic
1076958055 10:133751726-133751748 CTGGGCGGCTGCAGGGGCCCGGG - Intergenic
1076959039 10:133755025-133755047 CTGGGCGGCTGCAGGGGCCCGGG - Intergenic
1076960028 10:133758335-133758357 CTGGGCGGCTGCAGGGGCCCGGG - Intergenic
1076961012 10:133761634-133761656 CTGGGCGGCTGCAGGGGCCCGGG - Intergenic
1077051617 11:569135-569157 CGGGGCGCCCTTGGGGGCTCTGG + Intergenic
1077094578 11:793895-793917 TAGGGAGGCCTCAGGGGCTCCGG - Intronic
1077258960 11:1605177-1605199 CTGGGGGTCCCCAGGGGCTCAGG - Intergenic
1077309871 11:1883524-1883546 CCTGGGGGCCGCAGGGGCTGAGG + Exonic
1077319654 11:1935536-1935558 CCGGGCGGCCTCAGGGACTGGGG + Intronic
1077360868 11:2139585-2139607 GGCGGCGGTCGCAGGGGCTGGGG + Intronic
1077436203 11:2540370-2540392 CGGTGCGGCCTCACGGGGTCAGG + Intronic
1077635839 11:3840922-3840944 GGGGGCGGCGGCAGCGGCTCCGG + Exonic
1078066331 11:8081476-8081498 CGGGGCGGTGGCTGCGGCTCTGG - Intronic
1078230563 11:9438343-9438365 TGGGCCGGGCGCAGTGGCTCAGG + Intronic
1078405556 11:11067465-11067487 GGGAGCGGCTGCAGGAGCTCAGG + Intergenic
1078417901 11:11180687-11180709 CAGGGCGGCCTCAGGGGCAGGGG - Intergenic
1079205948 11:18414544-18414566 CTGGCCGGGCGCAGTGGCTCAGG + Intronic
1081636772 11:44727043-44727065 CGGGGCCGGGGCTGGGGCTCGGG - Intronic
1082085795 11:48048510-48048532 TGGGCCGGGCGCAGTGGCTCCGG + Intronic
1082105388 11:48215785-48215807 CGGGCCGGGAGCAGTGGCTCAGG - Intergenic
1083453006 11:62758890-62758912 GGGGCCGGGCGCAGTGGCTCAGG + Intergenic
1083572901 11:63769381-63769403 GGCGGCGGCCGCAGTGACTCGGG + Intergenic
1083728846 11:64642647-64642669 GGGGGCGGCCGAGGGGGCCCGGG - Intronic
1083940126 11:65891234-65891256 CGCGGCGGCCCCAGCGGCGCCGG + Exonic
1084085204 11:66851879-66851901 GGCGGCGGCTGCAGGAGCTCCGG - Exonic
1084148558 11:67277639-67277661 TGGCGCGGCCGCAGCTGCTCTGG + Intronic
1084149496 11:67281573-67281595 CCGGGCTGCCGCTGAGGCTCTGG + Intronic
1084265690 11:68004077-68004099 CCGGGCGGTCGCAGGGACTCCGG - Exonic
1084284261 11:68121310-68121332 CGGGGCGGCGGCGGCGGCTGCGG + Intronic
1084310447 11:68313215-68313237 CGGGGCGGCCGCGCGGCCGCTGG - Intronic
1084526667 11:69702477-69702499 CGGGGCCGCGGGAGGGGCGCGGG + Intronic
1084841550 11:71855519-71855541 AGGGCCGGCCGCAGTGGCTCAGG + Intergenic
1085300580 11:75456025-75456047 AGGGGAGGCTGCAGGGGCTGAGG + Intronic
1085520140 11:77132922-77132944 CGGGTCGGCTCCCGGGGCTCGGG + Intronic
1085588578 11:77735075-77735097 TGGGGCGGCGGCAGGGGCCTTGG + Intronic
1087014517 11:93542918-93542940 CGGGGCGGACTCAGGGGCCGGGG - Intronic
1088401063 11:109422945-109422967 CCGGGCCGCCGCGCGGGCTCCGG - Intronic
1088871420 11:113893471-113893493 TGGGCCGGCCGCGGTGGCTCAGG - Intergenic
1089556229 11:119317182-119317204 CGGGGCGGGCCCGGGCGCTCCGG - Intronic
1090403766 11:126465395-126465417 CGGGGCTGCAGCAGAGGCTGTGG - Intronic
1091237421 11:134031443-134031465 CGGAGAAGCCACAGGGGCTCGGG + Intergenic
1091286572 11:134411774-134411796 CGGGGCGCCCGCGGGGGCGCGGG + Intronic
1091550226 12:1530811-1530833 GGGGGCGGCCGGCGGGGCCCGGG - Intronic
1091558712 12:1594514-1594536 GGGGCCGGGCGCACGGGCTCCGG + Intronic
1092246556 12:6867400-6867422 CGGGGCGGCGGCAGGAGGGCGGG + Exonic
1092253566 12:6914678-6914700 GGAGGGGGCCACAGGGGCTCTGG - Intronic
1092743166 12:11649554-11649576 AGGGGCGGCCGCGGGGGCGCGGG - Intergenic
1092861894 12:12725641-12725663 CCGGGCGGGCGCGGGGGCTGGGG - Intergenic
1095097176 12:38154998-38155020 CGGGTCTGGCGCAGGGGCTACGG - Intergenic
1095349197 12:41188903-41188925 CCGGGCGGCCGCTGGGGCCGCGG + Exonic
1095752375 12:45727555-45727577 CGGCGCGGCGGCAGGAGCCCGGG + Intergenic
1096120921 12:49089105-49089127 AGGGGCTCCAGCAGGGGCTCAGG - Intergenic
1096500905 12:52063329-52063351 TGGCGTGGCCGCAGGGGCTGGGG + Intergenic
1097053565 12:56237609-56237631 TGGGGCGTAGGCAGGGGCTCCGG - Exonic
1097267543 12:57755032-57755054 CGGGGCGGGCGCCGGGGAGCGGG - Intronic
1097891470 12:64781190-64781212 CTGGGCGGCCGCAGCGGTGCCGG + Intronic
1099439994 12:82687378-82687400 CGGGGAGGACGCAGGAGCTGCGG + Exonic
1099494201 12:83325437-83325459 TGGGCCGGGCGCAGTGGCTCAGG + Intergenic
1101378547 12:104192131-104192153 CAGGGCTACAGCAGGGGCTCAGG + Intergenic
1102240242 12:111320517-111320539 CGAGGCGGCGGCAGGGGCGGAGG + Exonic
1102473777 12:113175504-113175526 GGGGCCGGGCGCAGTGGCTCAGG + Intronic
1102853954 12:116277496-116277518 CGAGGCGGCGGCGGCGGCTCCGG - Intergenic
1102997448 12:117361207-117361229 CGCGGCGGCCGCGGGCGCCCGGG - Intronic
1103120672 12:118376914-118376936 CGGGGCGGCCTCCGGGGCCTGGG + Intronic
1103322436 12:120099923-120099945 CGGGGCTGCCGCCTGGCCTCCGG - Intronic
1103474803 12:121210425-121210447 CGGCGCGGCGGCTGGGGCCCAGG - Intronic
1103930062 12:124445315-124445337 CGGGGCAGCCGCAGAGGGGCAGG - Intronic
1104016522 12:124965588-124965610 CGGGGGGCCCACAAGGGCTCTGG + Intronic
1104030445 12:125061858-125061880 CTGGCCGGGCGCAGTGGCTCAGG - Intergenic
1104624016 12:130338192-130338214 GGGGGCGGCGGCTGGGGGTCCGG + Intronic
1104940279 12:132391972-132391994 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940318 12:132392058-132392080 CGGGGTGGCCGGAGGGTCCCTGG - Intergenic
1104940343 12:132392115-132392137 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940370 12:132392172-132392194 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940396 12:132392229-132392251 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940423 12:132392286-132392308 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940450 12:132392343-132392365 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940477 12:132392400-132392422 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1104940504 12:132392457-132392479 CGGGGTGGCCGGAGGGTCCCGGG - Intergenic
1105000407 12:132687062-132687084 CGGGGCGGGCGGAGGCGCTACGG - Intronic
1105000648 12:132687831-132687853 CAGGTCGGCCGCAGCGGCGCGGG + Intronic
1105522212 13:21141006-21141028 CGGGGTGGCCTCAGGGACCCGGG + Intronic
1105785702 13:23747055-23747077 CTGTGGGGCAGCAGGGGCTCTGG + Intronic
1106075567 13:26458034-26458056 CGGAGCGGGGGCGGGGGCTCAGG - Intergenic
1106304090 13:28495031-28495053 CGGAGCGGGCTCCGGGGCTCGGG - Exonic
1108484279 13:50909160-50909182 CGGGCCAGGCGCAGTGGCTCAGG - Intergenic
1113378520 13:109784388-109784410 AGGAGCGGCCACAGTGGCTCAGG + Exonic
1113418559 13:110151696-110151718 CGGGGCTGCAGCTGGGGCTCGGG + Intronic
1113605512 13:111602323-111602345 TGTGGCAGCCGCAGGGGCACAGG - Intronic
1113859771 13:113473720-113473742 TGGGCCGGCCGCAGTGGCTCAGG + Intronic
1113910695 13:113839921-113839943 CGGGGCGGCTGTGGGGTCTCGGG + Intronic
1113925359 13:113938940-113938962 CAGGGAGGCCGCAGGTGCTGTGG - Intergenic
1114470359 14:22957037-22957059 CGGGCCGGGCGCAGGGGCTGGGG + Exonic
1114655129 14:24311289-24311311 CGGGGCGCCCGCTGGGGCTCCGG + Exonic
1115398584 14:32934899-32934921 CGGGGCGGCCGCGGGGGTGCCGG + Intergenic
1115906686 14:38209459-38209481 GGCGGCGGCAGCAGGGGCCCCGG + Exonic
1116067308 14:40000971-40000993 CGAGGCGGGCGCACGGGGTCAGG + Intergenic
1116817918 14:49599935-49599957 CGGGGCCGGGGCGGGGGCTCCGG + Intronic
1118351001 14:64972368-64972390 CGGGGCGGCGGCGGCGGCGCAGG - Intronic
1119793758 14:77377199-77377221 AGGGGCGGCCACAGGAGCTCTGG + Exonic
1119835756 14:77747715-77747737 CGGGGCGGCTGCCGGGGCGGGGG - Intronic
1121279358 14:92688038-92688060 TGGAGCGGCCGCAGGCGCACCGG + Exonic
1121319014 14:92980295-92980317 CTCGGCTGCCTCAGGGGCTCTGG - Intronic
1122582317 14:102778099-102778121 CGGGCCGGCCGGGGGGGCCCGGG + Intronic
1122591029 14:102851461-102851483 AGGGCCGGGCGCAGTGGCTCAGG + Intronic
1122723368 14:103734740-103734762 CAGGGCGGTCGCAGGGGAGCAGG + Exonic
1122886227 14:104711647-104711669 CGGGGCAGCTGCAGGAGGTCGGG - Exonic
1122937784 14:104967891-104967913 CGGGGCTTCCTCAGGAGCTCGGG - Intronic
1122947955 14:105021750-105021772 CGGGCCTGCTGCAGGCGCTCAGG - Intergenic
1123004454 14:105314686-105314708 CGGGGCGGCCGGGGGCGCGCGGG + Exonic
1123053733 14:105559797-105559819 CGGGGCAGGGGCAGGGGCACGGG - Intergenic
1123124751 14:105938247-105938269 CTGGGGGGCTGCAGGGGCACAGG - Intergenic
1202849996 14_GL000225v1_random:10154-10176 CTGGGAGGCTGCAGGGGCACGGG - Intergenic
1202855048 14_GL000225v1_random:44569-44591 CTGGGAGGCTGCAGGGGCACGGG - Intergenic
1202857471 14_GL000225v1_random:59859-59881 CTGGGAGGCTGCAGGGGCACGGG - Intergenic
1202859209 14_GL000225v1_random:71438-71460 CTGGGAGGCTGCAGGGGCACGGG + Intergenic
1202863483 14_GL000225v1_random:100280-100302 CTGGGAGGCTGCAGGGGCACGGG + Intergenic
1123631010 15:22259279-22259301 AGGAGCGGCTGCAGGGGCCCTGG + Intergenic
1123931813 15:25175571-25175593 GTGGGGGGCCACAGGGGCTCTGG + Intergenic
1123938820 15:25206921-25206943 TGAGGTGGCCACAGGGGCTCCGG + Intergenic
1124248837 15:28094725-28094747 AGGGGCGGCAGGAGGGGCCCGGG - Intronic
1124957232 15:34367332-34367354 CGCGGCGCCCGCAGCCGCTCGGG + Intergenic
1125578555 15:40770554-40770576 TGGGGCGGCCACGGCGGCTCCGG + Exonic
1125675838 15:41502256-41502278 CGGGGCGGGAGCGGGGGATCGGG - Intronic
1125999323 15:44194769-44194791 CAGGGCTCCGGCAGGGGCTCCGG + Intronic
1128153550 15:65377868-65377890 CGGGGCCGGGGCTGGGGCTCCGG + Exonic
1129154615 15:73709981-73710003 AGGGGTGGGAGCAGGGGCTCCGG + Intronic
1129644738 15:77419835-77419857 TGGCGCCGCCGCCGGGGCTCTGG - Intronic
1130115631 15:81002196-81002218 CGGGGCGGCGGCAGTGGCCGCGG + Exonic
1130204749 15:81865634-81865656 TGGGCCGGGCGCAGTGGCTCAGG + Intergenic
1130390183 15:83447841-83447863 GGTGGCGGCCGCGGGGACTCGGG + Intronic
1130996847 15:88908860-88908882 CTGGGTGGCAGCAGGGGCCCTGG - Intronic
1131133071 15:89912568-89912590 GGGCGCGGCGGCAGGGGCGCCGG + Intronic
1132398262 15:101489624-101489646 CGGGGCGGCGGCCGGGGCCCGGG + Exonic
1132491677 16:235055-235077 CGGGTCGGCAGCAGCGCCTCTGG + Intronic
1132514368 16:359410-359432 GGGTCCGGCCGCAGGGGCTGGGG + Intergenic
1132554766 16:567636-567658 CCGGGTGCCCGCAGGGGCTGTGG + Exonic
1132609352 16:807549-807571 CGGGACGGCCACAGGGGCCCAGG - Exonic
1132678333 16:1129858-1129880 CACAGCGGCCGCAGGGGCCCCGG - Intergenic
1132709227 16:1259073-1259095 CGGGGCAGCTGCAGGAGCTGCGG + Intergenic
1132733125 16:1372720-1372742 CGCAGCGGCTGCAGGAGCTCTGG + Intronic
1132735181 16:1382447-1382469 CGGGGCGGGGGCAGGGGCACAGG - Intronic
1132748364 16:1446242-1446264 CGGGGCAGCAGCAGGGGCAAGGG + Exonic
1132851538 16:2027015-2027037 AGGCGCGGCCGCAGCGGCTCCGG - Exonic
1132889580 16:2197030-2197052 CGGGCCGGCTCCAGGGGCACTGG - Intergenic
1132893199 16:2214608-2214630 CGCAGCGCCCGCAGGGCCTCGGG + Exonic
1132942282 16:2514188-2514210 CGCGGCGGCGGGAGGGACTCGGG + Intronic
1132945494 16:2529673-2529695 CAGGGCGGCCGCACAGGCCCTGG - Intronic
1133036521 16:3036784-3036806 CGGGGCGGGGGCAGGGGAACCGG - Intronic
1133051604 16:3120277-3120299 GGCGGCGGCGGCGGGGGCTCTGG + Exonic
1133770964 16:8867099-8867121 TGGGGCGGGCGCAGGGTCCCAGG - Intronic
1133784235 16:8963003-8963025 AGGGGCGGCCGCCGGGACCCCGG - Intronic
1136007288 16:27339775-27339797 CTGGGCAGCCGCAGTGGCTCAGG + Intronic
1136135791 16:28256214-28256236 GGGGGAGGCCGCAGTGGCCCAGG - Intergenic
1137054253 16:35735822-35735844 CTGGGCCGCGGCAGGGGCGCAGG - Intergenic
1137476000 16:48810774-48810796 CGGGGCGGGCACAGCGGGTCGGG + Intergenic
1138179767 16:54933299-54933321 CGGGCCGGGCGCCGGCGCTCCGG - Exonic
1138265278 16:55656006-55656028 CGGGGCGGCCGGCAGGGCGCGGG - Intronic
1138423350 16:56914188-56914210 TGGGCCGGGCGCAGTGGCTCAGG - Exonic
1138657550 16:58499899-58499921 GGGGGCGGATGCAGGGGCTGGGG + Intronic
1139215896 16:65123586-65123608 CCGGGCGGCTGCGGGCGCTCGGG - Intronic
1139475881 16:67202368-67202390 TGGGGGGGCAGGAGGGGCTCAGG - Intronic
1141116939 16:81316498-81316520 CGGGGCGGCAGTAGGGTCTGGGG + Intronic
1141658193 16:85427358-85427380 TAGGCCGGGCGCAGGGGCTCAGG + Intergenic
1141972014 16:87491227-87491249 AGGAGCGGCTGCAGGGGCCCTGG - Intronic
1142031361 16:87840077-87840099 CGGGGTGACCTCAAGGGCTCAGG + Intronic
1142192045 16:88722544-88722566 AGGGGCAGCAGCTGGGGCTCGGG + Intronic
1142251747 16:88995093-88995115 CGTGGAGGATGCAGGGGCTCAGG - Intergenic
1142298915 16:89244920-89244942 GGGTGCGGCCGCAGGTGCTGGGG - Intergenic
1142414674 16:89934866-89934888 CTGGGGGGCGGCACGGGCTCCGG + Exonic
1142631584 17:1229416-1229438 CGGGGCGGCGGCGGAGACTCCGG - Intergenic
1142670648 17:1486010-1486032 CGCGGCGGCCGCGCGGGTTCCGG - Intronic
1142697929 17:1643818-1643840 CGTGGGGGCCGCAGGCGCACGGG + Exonic
1142810560 17:2393796-2393818 CGCCGAGGCTGCAGGGGCTCGGG + Intronic
1143287539 17:5801426-5801448 CGGGCCAGGCGCAGTGGCTCAGG - Intronic
1143604984 17:7978262-7978284 GGGGCCGGGCGCAGTGGCTCAGG + Intergenic
1143893544 17:10120093-10120115 CGGGGCGGGGGCAGGGGGACAGG - Intronic
1144266478 17:13574396-13574418 AGGGCCGGGCGCAGTGGCTCAGG - Intronic
1144724853 17:17496633-17496655 CTCGGCGGCCGCAGGGGCGTCGG + Intergenic
1145915496 17:28571475-28571497 CATGGCGGCCGCCGGGGCTGCGG - Exonic
1146659741 17:34657669-34657691 CGGGGCAGAGGAAGGGGCTCTGG + Intergenic
1146787410 17:35731917-35731939 CGGGGCCGGGTCAGGGGCTCGGG + Intronic
1147110257 17:38256766-38256788 CTGGGCGGCCGCAGGGCGCCGGG - Intergenic
1147520494 17:41167776-41167798 TGGGGCGGCAGCAGGTGGTCTGG + Exonic
1147705527 17:42422580-42422602 CGGGCCGGGCGCGGGAGCTCTGG + Intronic
1147804538 17:43121092-43121114 CAGGCCGGGCGCAGTGGCTCAGG + Intronic
1148419255 17:47531665-47531687 CTGGGCGGCCGCAGGGCGCCGGG + Intronic
1148437317 17:47694395-47694417 CGGGGCCGGGGAAGGGGCTCCGG - Intronic
1148632888 17:49125761-49125783 CGGGGCGGCCGGACGGGCGGGGG - Intergenic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1148804912 17:50259171-50259193 CAGGGGGGCGGCGGGGGCTCAGG + Intergenic
1148911384 17:50944816-50944838 CGGGGCCGCCGCAGGAGCGCAGG - Intergenic
1149641499 17:58205864-58205886 AGGGGGGGCCACAGGGTCTCTGG + Exonic
1149741985 17:59055412-59055434 TGGGCCGGGCGCAGTGGCTCAGG + Intronic
1149833679 17:59893365-59893387 CGGGGCGGCGGCGCGGGCTCAGG + Intronic
1150069782 17:62140594-62140616 CCGGGCGGCCGCAAGGCCGCAGG + Intergenic
1150155729 17:62851336-62851358 CGGGGCAGCTTGAGGGGCTCTGG + Intergenic
1150389125 17:64780737-64780759 CGGGAGGGACGCAGGGACTCCGG - Intergenic
1150768305 17:68020159-68020181 CGGAGCGGCCGCAAGGGCCCCGG + Intergenic
1151716900 17:75835606-75835628 GTGGGCGGCTGCAGGGGCACAGG - Intronic
1151822500 17:76504287-76504309 TGGGGAGGCAGCGGGGGCTCAGG + Intergenic
1152354078 17:79798214-79798236 CGGGCCGGGCGCCGGGGTTCGGG - Intronic
1152392912 17:80013380-80013402 CGGAGGGGCTGCAGGGGCTGGGG - Exonic
1152402462 17:80075758-80075780 GGGGCCGGGCGCAGTGGCTCAGG - Intronic
1152436958 17:80282136-80282158 GGGGCCGGCCTCAGTGGCTCAGG - Intronic
1152562164 17:81083982-81084004 GGGGGCAGCCCCAGGGGCGCAGG - Intronic
1152636312 17:81431918-81431940 CTGGGTGTGCGCAGGGGCTCGGG - Intronic
1152699344 17:81811348-81811370 CGGGGCGGCCGCAGAGGACAGGG + Intronic
1152786087 17:82248837-82248859 CCGGGCGGGCGCTGGGCCTCGGG - Intronic
1152946245 17:83199073-83199095 TGGGGCTGCAGCAGGGGGTCGGG - Intergenic
1152965640 18:111853-111875 CCGGGAGGCCGCAGGGGCCCGGG + Intergenic
1154070573 18:11148835-11148857 TGGGCCGGCCGCAGGGGGCCGGG - Intergenic
1154151264 18:11908429-11908451 CCGGGCGGACGAAGCGGCTCCGG - Exonic
1154204434 18:12325204-12325226 CTGGGCGGCGGCACGGGCTCAGG + Exonic
1156171758 18:34494057-34494079 CGCGGCAGCAGCAGGGGCTGCGG - Intronic
1156275728 18:35581522-35581544 CAGGGCGCCCGCAGGCGCTCGGG - Intronic
1157529482 18:48409323-48409345 CGGCGCGGCCGGCGAGGCTCGGG - Intronic
1157610104 18:48950614-48950636 CGGGGCGCGCGCGGGGGCCCGGG + Exonic
1157610113 18:48950634-48950656 GGGGGCGCCCGCCGGGGATCGGG + Exonic
1157700187 18:49757400-49757422 CAGGTGGGCAGCAGGGGCTCTGG - Intergenic
1158436010 18:57435861-57435883 GGGGGCGGCGGCGGGGGCCCGGG + Exonic
1158454389 18:57593527-57593549 CGGGGCGGCTGCTGGGGGACAGG + Intergenic
1158938351 18:62384947-62384969 CGGGGCCGCCGCACGGGTCCGGG - Exonic
1158976512 18:62715785-62715807 AGCGGCGGCCGCGGCGGCTCTGG + Exonic
1159054433 18:63450377-63450399 CGGGGCGGCTGGCCGGGCTCGGG + Intergenic
1159221666 18:65472952-65472974 CGGGCCGGGCGCGGTGGCTCAGG - Intergenic
1160431918 18:78818731-78818753 AGGGGCGGCTTGAGGGGCTCAGG + Intergenic
1160540114 18:79616740-79616762 CGTGGAGGCCGCCGGGGCCCGGG + Intergenic
1160745390 19:708984-709006 GGGGGCGGCGGCACCGGCTCGGG - Intergenic
1160768700 19:821154-821176 CGGGGAGGCCGGAGGGGGTGGGG - Intronic
1160813828 19:1026462-1026484 GGGGGCGACCGAGGGGGCTCAGG + Intergenic
1160859960 19:1233576-1233598 CGGGGCTGCAGCAGGGCCTGGGG - Exonic
1160868044 19:1264746-1264768 CCAGGCAGCTGCAGGGGCTCAGG - Intronic
1160880188 19:1316121-1316143 CAGGGCGGCCTCAGGTGCTGGGG + Intergenic
1160905550 19:1450190-1450212 CGCGGCGCGGGCAGGGGCTCCGG - Intronic
1160913219 19:1484204-1484226 CTGGGCGGGCGCAGTGGCTCAGG + Intronic
1160930684 19:1568241-1568263 CCGGGCGGCGGCAGCGACTCTGG + Intergenic
1161074561 19:2279020-2279042 AGGGGTGGGGGCAGGGGCTCTGG + Exonic
1161103231 19:2431700-2431722 CGGGGCCGCCACAGCAGCTCTGG - Intronic
1161296573 19:3523302-3523324 TGGGGCGGCCGCATGGGCAGAGG + Intronic
1161313405 19:3607086-3607108 CTGGGCGGCTGGAGGGGCTGAGG - Intergenic
1161382151 19:3971086-3971108 CGTCGCGGCGGCAGGGGCGCGGG - Intronic
1161461889 19:4402659-4402681 CGCGGCGGCAGCAGCGGCGCGGG + Exonic
1161487623 19:4544217-4544239 AGGGGCGCCAGCAGGGCCTCCGG + Exonic
1161779068 19:6279530-6279552 AGGGGCGTCCCAAGGGGCTCCGG + Intronic
1162125746 19:8498744-8498766 CGGGGTGGCCCCCGGCGCTCCGG + Exonic
1162128245 19:8510882-8510904 CGCGGGGGCCGCGGGGGCGCCGG + Exonic
1162802497 19:13118858-13118880 CGGCGCGGCCGGAGGGGGGCGGG + Intronic
1162964018 19:14147348-14147370 AGGGGCGTCCCCATGGGCTCTGG - Intergenic
1162966050 19:14156577-14156599 GGGGGCGGGGGCAGGGGCTGGGG + Intronic
1163028362 19:14527459-14527481 CTGGCCGGACGCAGTGGCTCAGG - Intronic
1163103290 19:15109912-15109934 CGGGCCGGCAGCAGGGCCTGGGG + Exonic
1163126019 19:15244536-15244558 GGGGGCGGCTGCTGGGGCACAGG + Exonic
1163282314 19:16325324-16325346 GGGGGCGGCGGCGGCGGCTCCGG - Exonic
1163548426 19:17952294-17952316 CGGGCAGGGCGCAGGGACTCCGG + Intronic
1163592830 19:18203993-18204015 GGCGGCGGCAGCAGCGGCTCAGG + Exonic
1163821020 19:19496607-19496629 CGGGAGGGCGGCATGGGCTCCGG - Intronic
1164308473 19:24025862-24025884 CAGGCCGGGCGCAGTGGCTCAGG + Intergenic
1164309435 19:24033317-24033339 CGGGGCGGGGGCAGGGGGTGGGG + Intergenic
1164648140 19:29873752-29873774 CGGCGCGGGCGCGGGGGCGCGGG - Intergenic
1164958403 19:32405991-32406013 AGGGGCGGCCCCAGGGGCTCGGG - Intronic
1165463889 19:35960567-35960589 TGGGCCGGGCGCAGTGGCTCAGG - Intergenic
1165832735 19:38737278-38737300 CTGGGGGGCTGCAGGGGCACGGG - Exonic
1165925012 19:39321113-39321135 CGGGGAGGCCGGCGGGGCTGGGG - Intergenic
1166126347 19:40717284-40717306 CGGGGCGGCCGGAGGGGGGCGGG + Exonic
1166383936 19:42370075-42370097 CGGGAGGGCAGCAGAGGCTCGGG - Intronic
1166852839 19:45768667-45768689 CGGGGCGGGCGCAGCGGCTGCGG - Exonic
1166873146 19:45882825-45882847 CGGGGAGGCCGCAGGGGTGGGGG + Intergenic
1166984176 19:46649666-46649688 GAGGGCGGCCGCAGGGCCGCGGG + Exonic
1167093781 19:47362571-47362593 CGGGCGGGCCGCACGGGCCCCGG + Exonic
1167286919 19:48603568-48603590 CCGGGGGGCCGCTGGGGGTCCGG + Exonic
1167300413 19:48674388-48674410 GGGGGCGGCCACGGGGGCCCGGG + Intergenic
1167466023 19:49651527-49651549 CCGGGCGGCAGCAGGGGCGGCGG - Exonic
1167596796 19:50432317-50432339 CGGGGAGGGCGCCGCGGCTCTGG - Intergenic
1167615594 19:50531168-50531190 CTGGGGTGCCGCAGAGGCTCCGG - Intronic
1167624458 19:50578299-50578321 CGGGCCGGGCGTAGTGGCTCAGG + Intergenic
1168144907 19:54415509-54415531 CGGGGCGGACGCCGGGGCTGCGG - Exonic
1168307312 19:55442641-55442663 CGGGGCGGGCGCGGCGGCCCGGG - Exonic
1168315485 19:55483151-55483173 GGGGCCGGCGGCAGGGGCTGTGG - Exonic
1168351529 19:55678877-55678899 CCGGGCAGGTGCAGGGGCTCAGG + Intronic
1168455909 19:56508082-56508104 CGGGGCGGAGGCCGCGGCTCGGG + Intronic
1168476329 19:56678088-56678110 AGGGCCGGACGCAGTGGCTCAGG - Intergenic
925149181 2:1602873-1602895 CCAGGCTGCCGCAGGGGCCCAGG + Intergenic
925419215 2:3697944-3697966 AGGGTCGGGCGCAGTGGCTCAGG - Intronic
925610453 2:5697035-5697057 CGGGCCTGCCGCGAGGGCTCGGG - Exonic
926090022 2:10043596-10043618 CGTGCCGGCCGCAGGAGCTCCGG + Exonic
926136418 2:10339876-10339898 CTGGGCGCACGCAGGGGCTCAGG - Intronic
927472244 2:23385322-23385344 CGCGGCGACCGCCGGGGCTGCGG - Exonic
927714046 2:25341433-25341455 CGCCGCTGCCGCAGGGGCCCCGG - Intronic
928088437 2:28359863-28359885 AGGGGAGGCTGCTGGGGCTCCGG + Intergenic
928282911 2:29964459-29964481 AGGGGCTGCTGCTGGGGCTCAGG - Intergenic
929775387 2:44928355-44928377 CGGAGCGGCGGCCGGGGGTCGGG - Intergenic
929966911 2:46542991-46543013 CGGGGCCGGGGCGGGGGCTCCGG + Exonic
930011518 2:46941399-46941421 CCGGGCGGCAGCGGGGGCCCGGG - Exonic
930075675 2:47403596-47403618 CGGGGCGGCTGGAGAGGCACGGG - Intronic
930155938 2:48107699-48107721 AGGGGCTGCAGCAGGGGCTGAGG - Intergenic
930873907 2:56192900-56192922 CGGGGCTTCTGCAGGTGCTCCGG - Exonic
931649385 2:64454455-64454477 CGGGGCGGGGGCGGGGGCGCGGG - Exonic
932812181 2:74834659-74834681 CGGGGCGGCAGGCTGGGCTCTGG + Intronic
934993186 2:98935863-98935885 CGGGGTGGGCGCGGGGGCACCGG - Intronic
935218939 2:100995508-100995530 CGGGGAGGACGTAGGGGCTGGGG - Exonic
935591871 2:104852485-104852507 CTGGGCTGCCGCTCGGGCTCGGG + Intergenic
936047217 2:109197146-109197168 CAGGGCTGCAGCAGGAGCTCAGG - Intronic
937950899 2:127387556-127387578 GGGGGCTGCCGCAGGGCCCCCGG + Intronic
938234826 2:129697465-129697487 TGGGCCGGGCGCAGTGGCTCAGG + Intergenic
938455668 2:131460943-131460965 CGGGGCCGGGGCGGGGGCTCCGG + Intergenic
939021246 2:136960806-136960828 TGGGCCGGGCGCAGTGGCTCAGG + Intronic
940639635 2:156333019-156333041 CTGCGCGGGCGCAGGGGCTTCGG - Intronic
941295711 2:163736382-163736404 CTGGGCGGCCGCCGCGGCCCCGG - Intergenic
941664941 2:168235321-168235343 CGGGCCGGCCGTGGTGGCTCAGG - Intronic
942446198 2:176080430-176080452 CGCGGCAGCCGCAGCGGCTGCGG - Exonic
943181930 2:184555716-184555738 TGGGCCGGGCGCAGTGGCTCAGG + Intergenic
945110627 2:206356925-206356947 CGGGGCGGCCGGCCGGGCTGAGG + Intergenic
947418571 2:229921958-229921980 CGGCGCGGCGGCGGCGGCTCCGG + Exonic
947732061 2:232436760-232436782 CGGGGCAGCTGCAGGGGCAGGGG + Intergenic
948046581 2:234950789-234950811 AGGGGCAGCCGCAGGGGCTCGGG + Intergenic
948146537 2:235712297-235712319 CAGGCCGGGCGCAGTGGCTCAGG - Intronic
948690014 2:239696062-239696084 CAGGGCAGCCGCAGGGGTCCTGG - Intergenic
948805934 2:240453456-240453478 CGGGGCGGCGGCAGGCGATGCGG - Intronic
948824856 2:240569122-240569144 CGGGGCGGGCGCCGGGGCTGCGG + Intronic
948923221 2:241076808-241076830 AGGGCCGGGCGCAGTGGCTCAGG + Intronic
1169214726 20:3786509-3786531 CGGGGCGGCGGCGGCGGCGCCGG - Exonic
1169914689 20:10673608-10673630 CGCGGCGGCCGCAGGGGCAGCGG - Exonic
1170562638 20:17570180-17570202 CGCGGCGGTCGCAGGGACGCGGG - Exonic
1171891794 20:30724265-30724287 CCGGGCGGCCCCAGGATCTCAGG + Intergenic
1172252655 20:33490460-33490482 CGGGGTGGCCTCAGGAGCCCGGG - Intronic
1172277207 20:33686232-33686254 TGGGCCGCCCGCAGGGGCCCCGG + Exonic
1174211637 20:48883857-48883879 GGGGCCGGGCGCAGTGGCTCAGG + Intergenic
1174250969 20:49219319-49219341 GGGGAGGGCGGCAGGGGCTCTGG + Exonic
1175272599 20:57745202-57745224 GGGGGTGGGGGCAGGGGCTCTGG + Intergenic
1175847105 20:62065001-62065023 CGGGGCGGCGGCGGGGGCGGCGG + Exonic
1175985548 20:62762633-62762655 AGGGGCCGGCTCAGGGGCTCCGG - Exonic
1176039104 20:63055079-63055101 CGGGGCAGCCGGAGGGGCCAGGG + Intergenic
1176145938 20:63565499-63565521 CGGGCCTGCTGCAGGGACTCGGG + Exonic
1176181589 20:63752082-63752104 CGGGGCGGCCCCAAGGGTTCGGG - Intronic
1176258739 20:64167691-64167713 CAGGGTGCCCGCAGGGGCTGGGG + Intronic
1178434583 21:32547014-32547036 CAGGGCTGGCGCAGGGGATCTGG + Intergenic
1178534910 21:33403353-33403375 CGGGGCGGGGGCGGGGGCGCGGG + Exonic
1179464712 21:41563737-41563759 AGGGGCTGCAGCAGCGGCTCAGG + Intergenic
1179951585 21:44711602-44711624 AGGGGCGGCCGCGGGGCCCCCGG + Intergenic
1180037800 21:45258719-45258741 CTGGGCGGCCGCGGGGGGACTGG + Intergenic
1180413987 22:12692907-12692929 CTGGGAGGCGGCAGGGGCACGGG + Intergenic
1180965327 22:19785111-19785133 TGGGCCGGGCGCAGTGGCTCAGG + Exonic
1181000739 22:19986847-19986869 AGGGCGGGCCGCAGGGTCTCTGG - Intronic
1181031641 22:20150947-20150969 GGGGGTGGCCGCAGGGGCCCAGG + Intergenic
1181511763 22:23392570-23392592 GGGCGTGGCCGCAGGGGCCCAGG - Intergenic
1181670559 22:24423907-24423929 CTCGGCGGCCGCTGGGTCTCCGG - Intronic
1183313566 22:37124835-37124857 CCGGGCAGCCGCTGGGGCCCTGG - Intergenic
1183576614 22:38694579-38694601 CGGGCCAGGCGCAGTGGCTCAGG + Intronic
1183658554 22:39205242-39205264 CTGGCCGGGCGCAGTGGCTCAGG - Intergenic
1183961306 22:41413494-41413516 GGGGGCAGCCGCGGGGCCTCGGG + Intergenic
1184164853 22:42720970-42720992 CGGGGACCCCGCAAGGGCTCTGG - Intronic
1184281175 22:43438350-43438372 CGCGGAGGCTGCAGGGGCCCTGG + Intronic
1184386888 22:44181650-44181672 CACGGCGGGCGCTGGGGCTCCGG + Intronic
1185143599 22:49117297-49117319 CGGGGCTGAGGCAGGGGCTGGGG + Intergenic
1185232271 22:49690012-49690034 TGGAGCGGCTGCAGGGGCCCTGG - Intergenic
1185259542 22:49853877-49853899 CGGGGCCGCGGGAGGGGCGCGGG + Exonic
1185337473 22:50277023-50277045 TGGGCCGGGCGCAGTGGCTCAGG + Intronic
1185338277 22:50280431-50280453 CGGGGCGGCCGCAGGGGCTCTGG - Intronic
1185374253 22:50474852-50474874 CGGGGCGGCCCGAGGGGCGCGGG + Exonic
1185409485 22:50674525-50674547 CAGCGCGGCCGACGGGGCTCCGG + Intergenic
950087662 3:10272009-10272031 GGGGGCGGGCGCAGTGGCTCAGG - Intronic
950215279 3:11154467-11154489 GGGGGCGGCGGCGGGGGCGCCGG - Intronic
950316303 3:12004636-12004658 GGCGGCGGCTGCTGGGGCTCGGG - Exonic
951640367 3:24829331-24829353 AGCGGCGGCGGCAGGGGCTGAGG + Intergenic
952382893 3:32818207-32818229 GGGGGCGGCGGCGGGGGCCCTGG + Exonic
952798598 3:37266477-37266499 TGGGCCGGGCGCAGTGGCTCAGG - Intronic
952816784 3:37453102-37453124 GGGGGGGGGCGCCGGGGCTCTGG - Intronic
953246459 3:41198978-41199000 CAGGGCGGCGGCAGGGGCTCGGG - Intronic
953526162 3:43691361-43691383 CGCGGCGGCCGCACCGGCTCGGG + Intronic
954152086 3:48662713-48662735 CGGGGCGGCGGCAGGGGCCCGGG - Exonic
956400717 3:68877075-68877097 CGGGCCGGGCGCAGTGTCTCAGG + Intronic
959530734 3:107431541-107431563 CGCCGCCGCCGCCGGGGCTCGGG + Intergenic
960864289 3:122184301-122184323 CTGGGCGGCCGCTGCGGCCCCGG - Intronic
961674274 3:128555390-128555412 CGCGGCGGCCGCGGGCGCTGCGG + Intergenic
962309156 3:134313364-134313386 GGGGGCGCCCGCAAGGGCTAGGG + Intergenic
963606827 3:147419621-147419643 CGGGGCGGCAGCTCGGGCTTGGG - Intronic
966593947 3:181710600-181710622 GGGGGCGGGGGTAGGGGCTCAGG - Intergenic
966732553 3:183162858-183162880 CGGCGCAGCCGCCGGGGCCCGGG + Exonic
967272603 3:187743709-187743731 CGGGGGGGCAGCAGGAGCTAGGG - Intronic
968479430 4:826775-826797 CGGGGCGGCGGGCGGCGCTCAGG - Intergenic
968540815 4:1167439-1167461 CCGGGGGGCCCCAGGGGCTGCGG + Exonic
968596890 4:1490330-1490352 CGGGGTGGGGGCCGGGGCTCCGG - Intergenic
968647749 4:1748852-1748874 CGGGTCTGCAGAAGGGGCTCCGG - Intergenic
968671903 4:1856424-1856446 CGTGGCGGCCGCAGGAGCTGAGG + Intergenic
968698532 4:2043995-2044017 CGGGGGCGACGCAGGGGCTCTGG - Intergenic
968701190 4:2059061-2059083 GGGGGCGTCCGGCGGGGCTCGGG - Intergenic
968775436 4:2536964-2536986 CGGGGCGGCGGCGGCGGCTCGGG + Intronic
968952304 4:3701457-3701479 GGGGTGGGCCGCGGGGGCTCAGG + Intergenic
969597833 4:8158897-8158919 CCGGGCGGCAGCGGGGGCGCGGG - Intergenic
974047483 4:56908984-56909006 CGGGGCGGTCGGAGGGGCCCGGG + Intronic
974134069 4:57792335-57792357 CGGGCCGGGCGCGGTGGCTCAGG - Intergenic
976177977 4:82373630-82373652 CGGGGCGGCGGCAGCGGCAACGG - Exonic
978384700 4:108167954-108167976 CGCGGCGGCCGCCGGGATTCGGG - Exonic
978680647 4:111377598-111377620 TGGGCCGGGCGCAGTGGCTCAGG + Intergenic
978746167 4:112196883-112196905 CTGGCCGGGCGCAGTGGCTCAGG + Intergenic
979231298 4:118352185-118352207 CGGGGCGGCCGCGGAAACTCCGG - Intronic
981429836 4:144645990-144646012 CAGGGAGGCCGCCGGGGCCCGGG + Intergenic
982629923 4:157819416-157819438 CAGGGCAGCCGCAGGTGCCCTGG + Intergenic
984706924 4:182854254-182854276 CTGTTCGGCCGCAGCGGCTCTGG + Intergenic
985006014 4:185535672-185535694 CGCGGCGGGCGCGGGGGCTTCGG + Intergenic
985451642 4:190066427-190066449 CTGGGCGGCTGCAGGGGCCCGGG - Intergenic
985452628 4:190069718-190069740 CTGGGCGGCTGCAGGGGCCCGGG - Intergenic
985453615 4:190073015-190073037 CTGGGCGGCTGCAGGGGCCCGGG - Intergenic
985454605 4:190076308-190076330 CTGGGCGGCTGCAGGGGCCCGGG - Intergenic
985455593 4:190079601-190079623 CTGGGCGGCTGCAGGGGCCCGGG - Intergenic
985456577 4:190082895-190082917 CTGGGCGGCTGCAGGGGCCCGGG - Intergenic
985457565 4:190086195-190086217 CTGGGCGGCTGCAGGGGCCCGGG - Intergenic
985458552 4:190089488-190089510 CTGGGCGGCTGCAGGGGCCCGGG - Intergenic
985459541 4:190092788-190092810 CTGGGCGGCTGCAGGGGCCCGGG - Intergenic
985463792 4:190175557-190175579 CTGGGAGGCTGCAGGGGCCCGGG - Intronic
985543413 5:497644-497666 CAGGGGGGCTGCAGGGGATCTGG - Intronic
985714242 5:1446537-1446559 CGGGGCGGGCGCAGGGGGTGGGG - Intergenic
986330521 5:6713658-6713680 CGGGGCGGGCGCGGGGGCCGCGG - Intergenic
986330847 5:6714709-6714731 CGGGGAGGCCGCGGGGGCGGGGG + Intronic
987827460 5:23051122-23051144 CTGGCCGGGCGCAGTGGCTCAGG - Intergenic
988363823 5:30270442-30270464 TGGGCCGGGCGCAGTGGCTCAGG + Intergenic
989229840 5:39073968-39073990 CGGGCCGGCAGGCGGGGCTCCGG + Intronic
991900558 5:71455808-71455830 CCGGGCAGCCGCCGGGGCTCGGG + Exonic
995145978 5:108787318-108787340 GAGGGGGGCCGCAGGGGCTGAGG + Intronic
997292434 5:132747552-132747574 CGGGACGCCCGCCTGGGCTCTGG - Exonic
997581087 5:135017551-135017573 CGGGCCGGGCGCGGTGGCTCAGG + Intergenic
997583909 5:135033828-135033850 AGCGGCTGCCGGAGGGGCTCCGG - Exonic
997984479 5:138492010-138492032 CGGGCGGGGCGCAGGGGCGCAGG - Intergenic
1000010236 5:157224492-157224514 TGGGCCGGCCGCAGTGGCTCAGG + Intronic
1000345692 5:160312056-160312078 GGGGGCGCCCGCCGGGGCCCGGG - Intronic
1001065055 5:168529538-168529560 GGGGGCGGCCGCGGGGGCGGCGG + Exonic
1001381979 5:171311318-171311340 CGGGGCCGCCGGCGGGGCCCCGG - Intronic
1001395998 5:171419956-171419978 CCGGGCTGGCGCAGGGGCTGCGG - Exonic
1001481786 5:172093725-172093747 CGGGACTTCCGCAGGGGCACAGG + Exonic
1002006428 5:176238407-176238429 CGGGGCGGCGGCAGCGGCGGCGG - Exonic
1002067830 5:176661089-176661111 CGGGGTGGGCCCAGGGTCTCTGG - Intergenic
1002145357 5:177176155-177176177 CGGGCCGGGCGCAGTGGCTAAGG - Intronic
1002204688 5:177554352-177554374 CTTGGCGGCGGCGGGGGCTCGGG + Exonic
1002438820 5:179253360-179253382 CCGGCCGGGCGCAGTGGCTCAGG + Intronic
1002524239 5:179806670-179806692 GGCGGCGGCGGCAGGGGCCCCGG + Intronic
1004217076 6:13712251-13712273 CGGGGCGTGCGGAGCGGCTCAGG + Intergenic
1004924051 6:20402372-20402394 CGGGGCGGCGGCAGCGGCGGCGG - Exonic
1005522771 6:26614554-26614576 GGGCGCCGCCGCAGGGACTCAGG - Intergenic
1005826298 6:29633215-29633237 CGGGGCGGCTCCCGGGGCTCGGG - Intronic
1005883059 6:30074847-30074869 CAGGGCAGCCGCAGGCGCCCGGG - Intronic
1006114094 6:31766112-31766134 CGGGACGCCTGCAGGGGCACGGG + Intronic
1006785054 6:36660862-36660884 CGAGGGGGAGGCAGGGGCTCGGG - Intergenic
1006814317 6:36840038-36840060 GGGGGCGCCCGCAGGGGCCGGGG + Intergenic
1007391618 6:41552709-41552731 CGGGCCGGCAGCTGGGGATCCGG + Intronic
1007481260 6:42151630-42151652 CTGGCCGGGCGCAGTGGCTCAGG + Intergenic
1007842932 6:44731403-44731425 CAGGGCAGCAGCAGGGGTTCAGG + Intergenic
1008912354 6:56749083-56749105 TGGGCCGGGCGCAGTGGCTCAGG + Intronic
1008920883 6:56843511-56843533 CAGCGCGGCCGCAGAGGGTCCGG - Intronic
1009596273 6:65740523-65740545 CAGGCCGGGCGCAGTGGCTCAGG - Intergenic
1010296458 6:74203019-74203041 CAGGCCGGGCGCAGTGGCTCAGG - Intergenic
1013182980 6:107733608-107733630 AGGGTCCGCCACAGGGGCTCAGG + Intronic
1013225675 6:108118205-108118227 CGGCGCGGCCGCAGCATCTCCGG - Intronic
1013619325 6:111873024-111873046 CGGCGCGGCCGAGGCGGCTCCGG + Exonic
1015537841 6:134284374-134284396 TGGGCCGGCTGCAGTGGCTCAGG - Intronic
1015910195 6:138161887-138161909 CGGGGCGGCGGGCGGGGCGCGGG + Intergenic
1015976438 6:138795998-138796020 CGCGGCGGCGGGAGGGGCTGCGG + Intronic
1016386775 6:143537122-143537144 GTGAGCGGCCGCGGGGGCTCGGG - Intronic
1016798548 6:148144200-148144222 CTGGGGGGCTGCAGGGGGTCTGG - Intergenic
1018288188 6:162263670-162263692 AGGGCCGGCCGCGGTGGCTCAGG + Intronic
1019488824 7:1301618-1301640 CGGGGAGGGCACAGGGGCCCTGG + Intergenic
1019534979 7:1524042-1524064 CGGTGTGGCAGCCGGGGCTCTGG - Intergenic
1019626156 7:2016599-2016621 GGGCGAGGCTGCAGGGGCTCAGG + Intronic
1019689668 7:2403616-2403638 CGGGGCGGCGGCGGCGGCTGCGG + Exonic
1019808945 7:3149992-3150014 AGGGGCAGCTGCAGGAGCTCTGG - Intronic
1019966068 7:4499719-4499741 GGGGCCGGACGCAGTGGCTCAGG - Intergenic
1022427954 7:30285552-30285574 CGCGGCGGCCGCGGCGGCCCCGG + Exonic
1023842373 7:44104619-44104641 CGGGGAGGGCGCGGGGGGTCAGG - Exonic
1025803512 7:64809288-64809310 CGGGGCGGCTGGAGGGGCGGGGG + Intronic
1026014137 7:66659496-66659518 CTGGCTGGCCGCAGTGGCTCAGG + Intronic
1026827897 7:73595592-73595614 CTGGGGGGCTGCAGGGGCTGTGG - Intronic
1026874336 7:73870937-73870959 GGGGGAGGCTGCAGGGTCTCAGG + Intergenic
1026980511 7:74523961-74523983 GGGGCCGGCCTCGGGGGCTCTGG + Intronic
1027384031 7:77642481-77642503 TGGGCCGGGCGCAGTGGCTCAGG + Intergenic
1028385135 7:90245442-90245464 CGGGGCGACCGCCGAGGCCCAGG + Exonic
1029110875 7:98212447-98212469 CCGGGCCGCAGCAAGGGCTCCGG + Exonic
1029144632 7:98437059-98437081 CGGGCCGGGCGCAGTGGCTCAGG - Intergenic
1029238697 7:99143674-99143696 CGGGGCGGGCGAGGGGGCGCCGG + Intronic
1029537121 7:101163360-101163382 CGGGGGGGCGGCACGGGCTCGGG + Exonic
1030415834 7:109241361-109241383 CTGGCCGGGCGCAGTGGCTCAGG - Intergenic
1032704562 7:134410758-134410780 CGGGGCGGCGGCATGGGGGCAGG - Intergenic
1033159118 7:138981323-138981345 AGGGGCGGCCGCTGCGGCTGCGG + Intergenic
1034147235 7:148884123-148884145 CGGCCCGGCCGGCGGGGCTCCGG - Intronic
1034155745 7:148954961-148954983 CCAGGCAGCCGCAGGGGCCCAGG - Intergenic
1034155963 7:148956270-148956292 CTAGGCAGCCGCAGGGGCCCAGG + Intergenic
1034209987 7:149355237-149355259 CAGGCCGGGCGCAGTGGCTCAGG - Intergenic
1034234238 7:149554933-149554955 CGGGGCGGCTGGCCGGGCTCGGG - Intergenic
1034306251 7:150047566-150047588 GGGGACGGCGGCGGGGGCTCCGG - Intergenic
1034446256 7:151115617-151115639 CTGGGCGCGCGCAGGAGCTCCGG - Intronic
1034455400 7:151167484-151167506 GGGGGCGGCGGCGGGGGCCCGGG - Exonic
1034578857 7:152025670-152025692 CTGGGCGGAGGCAGCGGCTCGGG + Intronic
1036211520 8:6844807-6844829 CGTGGGGGCTGCAGGGTCTCGGG - Intergenic
1036398241 8:8386531-8386553 CCGGGCGGCGGCAGGGACTGCGG - Intergenic
1036578827 8:10054400-10054422 CCGGGGGGCGGCAGGGGCGCGGG - Exonic
1037788898 8:21919693-21919715 GGCGGCGGCGGCAGCGGCTCCGG + Exonic
1038612723 8:29070250-29070272 CTGGGTGCCCGCAGGGGCTGGGG - Exonic
1039873554 8:41567176-41567198 CGGGGAGGCCGCTAGGGCTGCGG - Intergenic
1040286336 8:46102350-46102372 TGGGTGGGCCGCAGGGACTCAGG - Intergenic
1040288039 8:46110371-46110393 CGGGATGGCCACAGGGACTCAGG - Intergenic
1040288279 8:46111455-46111477 TGGGCAGGCCGCAGAGGCTCAGG - Intergenic
1040288426 8:46112105-46112127 TGGGCGGGCCGCAGGGGGTCTGG - Intergenic
1040289909 8:46118976-46118998 CGAGGGGGCTTCAGGGGCTCAGG - Intergenic
1040291979 8:46130168-46130190 TGGGCAGGCCGCAGGGACTCAGG - Intergenic
1040292765 8:46133871-46133893 TGGGTGGGCCGCAGGGACTCGGG - Intergenic
1040293914 8:46139477-46139499 TGGGCAGGCCGCAGGGGCTCAGG - Intergenic
1040300625 8:46186178-46186200 TGGGCAGGCCGCAGGGACTCAGG - Intergenic
1040302767 8:46196497-46196519 TGGGCAGGCCGCAGGGACTCAGG + Intergenic
1040303993 8:46202667-46202689 TGGGCCGGCCACAGGGACTCAGG + Intergenic
1040307309 8:46218834-46218856 TGGGCAGGCCGCAGGGTCTCAGG - Intergenic
1040307365 8:46219091-46219113 TGGGCGGGCCGCAGGGACTCAGG - Intergenic
1040309265 8:46228239-46228261 TGGGAGGGCCGCAGGGACTCAGG + Intergenic
1040309572 8:46229757-46229779 TGGACCGGCCGCAGGGACTCAGG + Intergenic
1040317631 8:46273276-46273298 TGGGGGGGCCTCAGGGACTCAGG + Intergenic
1040324597 8:46335343-46335365 TGGGGGGGCCTCAGGGACTCAGG + Intergenic
1040325496 8:46339449-46339471 TGGGCGGGCTGCAGGGGCTCAGG + Intergenic
1040329044 8:46376625-46376647 TGGGCCAGCCGCAGGGACTCAGG + Intergenic
1040332000 8:46390457-46390479 GGAGGGGGCCGCAGGGACTCAGG + Intergenic
1040338848 8:46429782-46429804 AGGGCGGGCCGCAGGGACTCAGG + Intergenic
1041201640 8:55455246-55455268 CGCGGCGGCCGCAGCGGCTGCGG + Intronic
1041547647 8:59063700-59063722 CGGGCCGGGCGCAGTGGCTTAGG - Intronic
1041690374 8:60680362-60680384 CGGGGCGGGCGCGGCGGCGCGGG + Intronic
1044669627 8:94665773-94665795 CTGGCCGGGCACAGGGGCTCAGG - Intronic
1045216906 8:100158067-100158089 CGCGGCCGCCGCACCGGCTCTGG - Intronic
1045277387 8:100720981-100721003 TGGGGCGCCGGCAGGAGCTCCGG + Intronic
1046108223 8:109691576-109691598 CCGGGCGGCTGCTGGGGCTGAGG + Exonic
1046547417 8:115669073-115669095 CGGGGCGGCGGCGGCGGCGCGGG - Intronic
1047458399 8:125037953-125037975 CGGGTCAGAAGCAGGGGCTCTGG + Intronic
1048649874 8:136463721-136463743 CAGGCCGGGCGCAGCGGCTCAGG + Intergenic
1048812637 8:138302690-138302712 GGGGGAGGCCCCAGGGACTCAGG - Intronic
1049417201 8:142500491-142500513 AGGGGCGGCTGCAGGGGTCCAGG + Intronic
1049419656 8:142511087-142511109 CGGGCCGGCGGGAGGGGCGCCGG + Intronic
1049460775 8:142726767-142726789 CAGGGCGTTCGCAGCGGCTCAGG - Intergenic
1049585125 8:143429427-143429449 CGGGGCGGCCCCGGGAGCGCGGG - Exonic
1049647025 8:143740137-143740159 GGGCGCGGCGGGAGGGGCTCGGG - Intergenic
1051130148 9:13851532-13851554 CGGGCCGGGCGCGGTGGCTCAGG + Intergenic
1051876757 9:21802168-21802190 CGGGGCGGCCGCCGCGGCGGGGG - Intergenic
1051936366 9:22447198-22447220 CTGGGCGGCCGCAGGAACGCTGG - Exonic
1056078236 9:83062878-83062900 GGGGGCGGCCGAGAGGGCTCCGG + Exonic
1056182546 9:84100000-84100022 CTGGCCGGGCGCAGTGGCTCAGG + Intergenic
1057259860 9:93577247-93577269 GGGGGAGGCGGCGGGGGCTCCGG - Intronic
1057311508 9:93946063-93946085 CGGAGCTGCCGCGGGGGCTGGGG + Intergenic
1057363848 9:94400089-94400111 CTGGCCGGGCGCAGTGGCTCTGG - Intronic
1057517936 9:95737480-95737502 TGAGGGGGCCGCAGGGGCCCTGG - Intergenic
1057659486 9:96987985-96988007 CTGGCCGGGCGCAGTGGCTCTGG + Intronic
1059149915 9:111940005-111940027 CAGGCCGGGCGCAGGGGCTTAGG - Intergenic
1059234500 9:112750690-112750712 CCGGGCGGCCGCGGCGCCTCGGG + Intergenic
1059769784 9:117414630-117414652 CGCGGCGGCGGCGGCGGCTCCGG + Exonic
1060770113 9:126326616-126326638 CGGGGCGGCGGCGCGGGCTCGGG + Intergenic
1060984039 9:127809705-127809727 CGGGCCGGACGCAGGTGCTGCGG + Exonic
1061347938 9:130042448-130042470 CGGGGCGAGCGCCGGGGGTCGGG - Intronic
1062102280 9:134734508-134734530 CGGGACGCCCGCAGGGCCCCAGG - Intronic
1062102719 9:134736948-134736970 GGAGGCGGCCCCAGGGCCTCAGG + Intronic
1062332718 9:136051594-136051616 GCGGGCGGCCGCAGAGGCGCCGG + Intronic
1062592645 9:137281087-137281109 CGGGGCGGCCTGGGGGACTCAGG - Exonic
1062729695 9:138102051-138102073 CAGGGCTGCTGCTGGGGCTCAGG - Intronic
1203740847 Un_GL000216v2:175732-175754 CTGGGAGGCTGCAGGGGCACGGG - Intergenic
1203654522 Un_KI270752v1:10084-10106 GGGGGCGGGGGCAGGGGCTGGGG + Intergenic
1185482966 X:461208-461230 CGGGGCGGCAGCCGGGGCCGGGG - Intergenic
1185558689 X:1041426-1041448 CGGGAGGGCCGCAAGGGTTCGGG - Intergenic
1187281269 X:17860434-17860456 CGGGGTGGCCGCACCAGCTCGGG - Intronic
1187826117 X:23334552-23334574 CGGGGAGGCCGCGGGGGGTGGGG + Exonic
1187900847 X:24025574-24025596 CGGGGCGCCAGCAGGGGCCGAGG - Intronic
1189323015 X:40097544-40097566 CGGGGCGGGCTCGGGGCCTCCGG + Intronic
1189331378 X:40146713-40146735 CGAGGCGCCCGCAGGGCCTAGGG - Intronic
1189821477 X:44873359-44873381 GGCGGCGGCGGCAGGGGCTGCGG - Intronic
1192422512 X:71046107-71046129 CAGGCCGGGCGCAGTGGCTCAGG + Intergenic
1199600796 X:149540163-149540185 CGGGGCTGCGGGCGGGGCTCGGG - Intergenic
1201180036 Y:11334100-11334122 CTGGGAGGCTGCAGGGGCACAGG - Intergenic