ID: 1185340149

View in Genome Browser
Species Human (GRCh38)
Location 22:50287495-50287517
Sequence GGGTCCAGGGGACCAATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 199}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185340132_1185340149 3 Left 1185340132 22:50287469-50287491 CCCACCCCTGCCCGCCCAGGTCA 0: 1
1: 0
2: 7
3: 52
4: 454
Right 1185340149 22:50287495-50287517 GGGTCCAGGGGACCAATGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 199
1185340127_1185340149 24 Left 1185340127 22:50287448-50287470 CCACCCTGGATATGGACAAGCCC 0: 1
1: 0
2: 1
3: 10
4: 134
Right 1185340149 22:50287495-50287517 GGGTCCAGGGGACCAATGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 199
1185340129_1185340149 20 Left 1185340129 22:50287452-50287474 CCTGGATATGGACAAGCCCCACC 0: 1
1: 0
2: 1
3: 8
4: 95
Right 1185340149 22:50287495-50287517 GGGTCCAGGGGACCAATGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 199
1185340134_1185340149 -1 Left 1185340134 22:50287473-50287495 CCCCTGCCCGCCCAGGTCATAGG 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1185340149 22:50287495-50287517 GGGTCCAGGGGACCAATGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 199
1185340128_1185340149 21 Left 1185340128 22:50287451-50287473 CCCTGGATATGGACAAGCCCCAC 0: 1
1: 0
2: 0
3: 13
4: 87
Right 1185340149 22:50287495-50287517 GGGTCCAGGGGACCAATGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 199
1185340141_1185340149 -8 Left 1185340141 22:50287480-50287502 CCGCCCAGGTCATAGGGGTCCAG 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1185340149 22:50287495-50287517 GGGTCCAGGGGACCAATGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 199
1185340136_1185340149 -2 Left 1185340136 22:50287474-50287496 CCCTGCCCGCCCAGGTCATAGGG 0: 1
1: 0
2: 1
3: 13
4: 146
Right 1185340149 22:50287495-50287517 GGGTCCAGGGGACCAATGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 199
1185340133_1185340149 2 Left 1185340133 22:50287470-50287492 CCACCCCTGCCCGCCCAGGTCAT 0: 1
1: 0
2: 0
3: 36
4: 390
Right 1185340149 22:50287495-50287517 GGGTCCAGGGGACCAATGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 199
1185340131_1185340149 4 Left 1185340131 22:50287468-50287490 CCCCACCCCTGCCCGCCCAGGTC 0: 1
1: 0
2: 7
3: 74
4: 731
Right 1185340149 22:50287495-50287517 GGGTCCAGGGGACCAATGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 199
1185340140_1185340149 -7 Left 1185340140 22:50287479-50287501 CCCGCCCAGGTCATAGGGGTCCA 0: 1
1: 0
2: 1
3: 18
4: 104
Right 1185340149 22:50287495-50287517 GGGTCCAGGGGACCAATGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 199
1185340138_1185340149 -3 Left 1185340138 22:50287475-50287497 CCTGCCCGCCCAGGTCATAGGGG 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1185340149 22:50287495-50287517 GGGTCCAGGGGACCAATGGAGGG 0: 1
1: 0
2: 0
3: 15
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185340149 Original CRISPR GGGTCCAGGGGACCAATGGA GGG Intronic
900106215 1:982205-982227 GGGTCCAGGCCACAAATAGATGG + Intergenic
900357213 1:2270738-2270760 GAGTCCAGGGGCCCAGAGGAAGG - Intronic
900414465 1:2528612-2528634 GGGTCCAGGGGGCCACTGGCAGG + Intergenic
900783718 1:4634320-4634342 GGGTCCCGGGTACCCGTGGACGG - Intergenic
901508608 1:9702397-9702419 GAGTCCACAGGACCACTGGATGG - Intronic
901768599 1:11519298-11519320 GGGTCCTGGGTACCCAGGGAGGG - Intronic
901884706 1:12214915-12214937 GGACACAGGGGACCAAGGGATGG + Intergenic
903266129 1:22159155-22159177 GGGTCCAAGGGTCCAAGGAAGGG + Intergenic
903361780 1:22781506-22781528 GGATCCTGGGGACCAATGCAAGG - Intronic
904026635 1:27508026-27508048 GGTTCCAGTGGACAAGTGGAGGG - Intergenic
904106728 1:28090845-28090867 GGGTCCTGTAGACCAATGTAAGG - Intergenic
904599689 1:31666607-31666629 GGGTTCAGGGGACCTAGGAAGGG - Intronic
906250699 1:44308713-44308735 TGGGCCAGGGGACCAATGAGAGG - Intronic
906834238 1:49066098-49066120 GGGATCAAGGGACAAATGGAAGG + Intronic
908213208 1:61922595-61922617 AGGTCCAGTGGAGCACTGGAAGG - Intronic
908396292 1:63728607-63728629 GGGTCCAGCAGACCCTTGGAGGG - Intergenic
911232335 1:95374357-95374379 GGGTGCAGCTGACCAATAGATGG + Intergenic
911856587 1:102884792-102884814 GGGTCAAGCGGACGACTGGAGGG - Intronic
912230087 1:107783317-107783339 GGGGCCAGGAGACCAACTGAGGG + Intronic
912480586 1:109979519-109979541 GGGTCCAGGCTAACCATGGAGGG - Intergenic
915029650 1:152867133-152867155 GAATCCAGGTCACCAATGGAGGG + Intergenic
915119905 1:153623263-153623285 GGATCCAGGGCACCAGTGAAGGG + Intronic
915762459 1:158329149-158329171 GGGTAGAGGGGATCAAAGGATGG - Intronic
916886905 1:169078292-169078314 GTGCCCAGGGGAACCATGGATGG - Intergenic
917845874 1:179019859-179019881 GAGTACAGGGGACCACTGAAGGG - Intergenic
918873443 1:190007162-190007184 TGTTCCAGGGAACAAATGGAGGG - Intergenic
920518353 1:206603157-206603179 AGGGCCAGTGGAGCAATGGAAGG + Exonic
920703553 1:208235584-208235606 GGGACCAGGGAACAAACGGAGGG + Intronic
923631210 1:235650206-235650228 GTGGCCGGGGGACCACTGGAGGG + Intronic
1065365916 10:24936805-24936827 GGGTCCTGGGGACCTATGGGAGG - Intronic
1065435010 10:25696599-25696621 GGGCCCAGGGGAGACATGGAAGG + Intergenic
1065721984 10:28636131-28636153 GGGCCCAGTGATCCAATGGAGGG + Intergenic
1067038557 10:42936103-42936125 GGGTGCAGGGGACCTAGGTAGGG - Intergenic
1067541890 10:47160801-47160823 GGCCCCTGGGGACCCATGGAAGG + Intergenic
1068005168 10:51384636-51384658 AGGACCAGGGGAAGAATGGAGGG - Intronic
1075602417 10:123779979-123780001 GGGTTCAGGTGACCAGAGGAAGG - Intronic
1075809395 10:125213814-125213836 GGCACCAGGGGACGAATGAATGG - Intergenic
1076470441 10:130714523-130714545 GGGTCCAGGGCACCACAGCAAGG + Intergenic
1077024824 11:434447-434469 AGGACCAGGAGACCAATGCACGG + Intronic
1077070681 11:670114-670136 TGGGGCAGGGGACCGATGGAAGG + Intronic
1077207000 11:1349532-1349554 TGGTCCAGAGGCCCAGTGGAGGG - Intergenic
1077298835 11:1838096-1838118 CGGTCCAGGGGACCTCTGCAGGG + Intergenic
1077463326 11:2721833-2721855 GGGGCCAAGGGACAGATGGATGG - Intronic
1081578455 11:44334561-44334583 GGGTCCAGGGGGCCCCTGGCTGG - Intergenic
1083336269 11:61923613-61923635 GGGTCAAGTGGACCAAGGAAGGG - Intergenic
1083419851 11:62546605-62546627 GGGTCCGGGGCACCAAGGGCGGG - Intronic
1084557715 11:69884794-69884816 GGGTCCAGGAGACCAAGGTGGGG - Intergenic
1085127438 11:74011297-74011319 GGGCCCAGGGGACCTAAAGAGGG - Intergenic
1085364946 11:75932000-75932022 AGGTCCAGTGGTCCAATGGATGG + Intronic
1088585779 11:111359091-111359113 GGGTGCAGGGGACCCACAGAAGG - Intronic
1090163080 11:124516434-124516456 TGGTCCAGGGGTAAAATGGAAGG + Intergenic
1091796030 12:3297937-3297959 GGGTGCCGGGGACCACAGGAGGG - Intergenic
1093906904 12:24703852-24703874 GGGTCAAGGGGACAGATGGAGGG - Intergenic
1095126131 12:38479570-38479592 CTGTCCAAGGGACCAAAGGATGG - Intergenic
1095741502 12:45611373-45611395 GGGTCCAGCCGACGAAAGGATGG - Intergenic
1096105809 12:48996683-48996705 GGGACCAGTGGACCCAAGGATGG + Exonic
1097246817 12:57611595-57611617 GGGTCCAGATGTCCAGTGGAAGG - Intronic
1100351605 12:93788950-93788972 TGCTCCAGGGGTCCAAAGGAAGG - Intronic
1101927309 12:108983479-108983501 GGGCCCAGGGGGCCAAGGGGTGG - Intronic
1102205715 12:111089525-111089547 GGGTCCAGGAGAGCACTGTAGGG - Intronic
1102215787 12:111160630-111160652 ATGTCCAGGGAGCCAATGGAGGG + Intronic
1102245598 12:111353764-111353786 GGGTACTGGGGAGCCATGGAAGG + Intergenic
1102673544 12:114640260-114640282 GGGCCCCAGGGATCAATGGATGG - Intergenic
1103305739 12:119962593-119962615 GGGCCCACTGGACCCATGGAAGG - Intergenic
1103567762 12:121825417-121825439 GGATCCAGGGCACTCATGGAGGG + Intronic
1104078717 12:125411951-125411973 AGGTCCAGGGGACCCAAGGAAGG - Intronic
1104635407 12:130435393-130435415 GGGCAGAGGAGACCAATGGAGGG - Intronic
1105210683 13:18255046-18255068 GGGTCCTGGGGAGCCACGGAAGG - Intergenic
1105913256 13:24890824-24890846 GGGTCCAGGCAGCGAATGGAGGG - Intronic
1108890655 13:55254123-55254145 GGATCTAGGGCACAAATGGAAGG - Intergenic
1110694563 13:78472943-78472965 GGTGACAGGGGACCAACGGAGGG - Intergenic
1112353449 13:98655302-98655324 GGCTCCAGGGGGCCAACTGAGGG + Intergenic
1113437234 13:110302587-110302609 AGGACCAGGAGAACAATGGAGGG + Intronic
1113893499 13:113748883-113748905 GCTTCCAGGGGAGCAACGGAGGG + Intergenic
1114335472 14:21685034-21685056 GGATCCCGGGTACAAATGGAGGG - Intergenic
1120922052 14:89764195-89764217 GGATCCAGGGCACCTAGGGAGGG + Intergenic
1121667755 14:95685962-95685984 GGGTCGTGGGGAGCAAAGGAGGG + Intergenic
1122268477 14:100557641-100557663 GGGTGCAGGAGCCCAGTGGATGG - Intronic
1122301917 14:100736460-100736482 TGGCGCAGGTGACCAATGGATGG - Exonic
1122877931 14:104677411-104677433 GAGTCCAGGGCAGCAATGGGGGG - Intergenic
1123676500 15:22714827-22714849 GGCTCCAGGGTACCCCTGGATGG + Intergenic
1124328718 15:28789087-28789109 GGCTCCAGGGTACCCCTGGATGG + Intergenic
1132089552 15:98936802-98936824 GGGTGCTGGGGACCAATGCTTGG - Intronic
1132399420 15:101496390-101496412 GGGACCAGGGCACCAAGGGAGGG - Intronic
1134024201 16:10942092-10942114 GGCTCCAGGGTACCCCTGGATGG - Exonic
1135590884 16:23704684-23704706 GGGTCCCGGGGACACTTGGAGGG + Intronic
1139511348 16:67430240-67430262 GGGTTCAGGGGAGCAAGGCAGGG + Intergenic
1145077250 17:19866839-19866861 GGGTGCAGGGGACCAGTGCTGGG + Intronic
1146208132 17:30922192-30922214 GGGTCCAGGGGGCCGAGGGCGGG - Intronic
1146269481 17:31475109-31475131 GGGTCCAGGGCCCACATGGAAGG + Intronic
1151729710 17:75904113-75904135 GGGTGCAAGGATCCAATGGAGGG + Intronic
1153762733 18:8347593-8347615 GGGTCCAGGTGCCTGATGGAAGG - Intronic
1156489531 18:37487988-37488010 GGGGCCAGGGGAAGACTGGAAGG - Intronic
1156498245 18:37540253-37540275 GGGGCCAGGGAGCCAGTGGACGG - Intronic
1158639114 18:59188227-59188249 AGGTCCAGTGTACCAATGAATGG + Intergenic
1159072996 18:63646835-63646857 GGTTACAGGGGACCAATCTATGG + Intronic
1160657723 19:281937-281959 GGGTCCAGGGGAGGACTGGGGGG + Intronic
1160832865 19:1111695-1111717 GGGTCCAGGGGCCTAGGGGAGGG - Intronic
1163403846 19:17110536-17110558 GAGTCCAGGGGGCCAAAGGCTGG + Intronic
1163721046 19:18898459-18898481 GGGTGCAGGGCAGGAATGGAAGG + Intergenic
1164558512 19:29271493-29271515 GGGGTCAGGGCACCACTGGATGG - Intergenic
1164815671 19:31200555-31200577 GTGTCCAGTGGAGGAATGGAGGG + Intergenic
1166210682 19:41304856-41304878 GCTGCCAGGAGACCAATGGATGG + Intronic
1166385131 19:42376461-42376483 GGGCCCTGGGGACCCATGGGAGG + Exonic
1166665985 19:44680719-44680741 GGGCACAGGGGAGCCATGGAGGG - Intronic
1166784073 19:45357413-45357435 GGGACCAGGAGGCCCATGGAGGG + Intronic
1167270162 19:48501908-48501930 GGGTCCAGGAGAGGAACGGAAGG - Intronic
1167477866 19:49711462-49711484 GGGTACAGGGGTGCAAAGGAAGG - Intronic
1167482169 19:49739831-49739853 GGGTCCACGGGAACAATGGGGGG - Exonic
1167717628 19:51154163-51154185 GGGTCCAGGGTCCCTCTGGAGGG - Intergenic
1168705768 19:58469524-58469546 GTGCCCAGGGCACCAAAGGAAGG - Intronic
925339349 2:3125512-3125534 GGGTGGAGGGGAACGATGGAAGG - Intergenic
925339397 2:3125793-3125815 GGGTCCTGGGCAGCCATGGAGGG + Intergenic
925845312 2:8028521-8028543 GGCTCCAGGGGACAGAGGGAGGG + Intergenic
925903070 2:8522508-8522530 GGGCCCAGGAGACCCAAGGAGGG - Intergenic
926653939 2:15378316-15378338 ATGTCCAGGGTACAAATGGAAGG + Intronic
926695107 2:15765687-15765709 GGGTCCAGGGGAGCCATGCACGG - Intergenic
927117242 2:19916948-19916970 GGGTCCCTGGGACCCATGTAGGG + Intronic
927699661 2:25259739-25259761 GGCTCCAGGGGTCAAAGGGAGGG + Intronic
928396073 2:30944248-30944270 GGGGCCTGGGGACCAACTGAGGG - Intronic
931694553 2:64861944-64861966 GGGCCCAGGGCACAGATGGAGGG - Intergenic
933633293 2:84680617-84680639 GGGACATGGGGAGCAATGGAAGG + Intronic
937867015 2:126760022-126760044 CAGACCAGGGGACCAATGCAGGG - Intergenic
938178916 2:129162408-129162430 GCTTCCAGGGAACCCATGGAAGG - Intergenic
943809506 2:192166708-192166730 GGGGCCAGGAGAAAAATGGATGG + Intronic
944122140 2:196251695-196251717 GGGACCAGGGAACAAATTGAAGG - Intronic
947996798 2:234534766-234534788 GAGCCCAGGGGAACAATGGAGGG - Intergenic
948156397 2:235786882-235786904 GGGCCAGGAGGACCAATGGACGG - Intronic
948456205 2:238105737-238105759 GGGTCCTGGGGAGCCACGGAAGG + Intronic
948645472 2:239401217-239401239 GGTTTCAGCGGGCCAATGGAAGG - Intronic
948728500 2:239948988-239949010 GGCTCCAGGGGAGCAAGGAAGGG - Intronic
948834095 2:240616249-240616271 GGGACCACGAGCCCAATGGAAGG - Intronic
1170835302 20:19878754-19878776 GGGTCGAGTGGGCCCATGGATGG - Intergenic
1171291829 20:23986737-23986759 GGGTCCTGGGGAGCCACGGAAGG - Intronic
1174072366 20:47908328-47908350 GGGGTCAGGGGACCCATGCAGGG - Intergenic
1174146633 20:48456634-48456656 GGGGTCAGGGGACCCATGTAGGG + Intergenic
1174416155 20:50368599-50368621 GGGTAAAGGGGAGCCATGGAAGG - Intergenic
1179441829 21:41400196-41400218 GGTGCCAGGGGACCAGGGGAGGG + Intronic
1180765572 22:18344369-18344391 GGGTCCTGGGGAGCCACGGAAGG + Intergenic
1180780744 22:18518023-18518045 GGGTCCTGGGGAGCCACGGAAGG - Intronic
1180813457 22:18775330-18775352 GGGTCCTGGGGAGCCACGGAAGG - Intergenic
1181199639 22:21209660-21209682 GGGTCCTGGGGAGCCACGGAAGG - Intronic
1181400120 22:22646198-22646220 GGGTCCTGGGGAGCCACGGAAGG + Intronic
1181428365 22:22858667-22858689 GAGTCCAGGGGACTAATCCAGGG - Intronic
1181649244 22:24249592-24249614 GGGTCCTGGGGAGCCACGGAAGG - Intergenic
1181702093 22:24627296-24627318 GGGTCCTGGGGAGCCACGGAAGG + Intronic
1182109164 22:27710744-27710766 GGGGCCATGGGAGCCATGGAGGG - Intergenic
1184693794 22:46129039-46129061 GGGGCTAGGGAACCAAAGGAGGG - Intergenic
1185340149 22:50287495-50287517 GGGTCCAGGGGACCAATGGAGGG + Intronic
1203227194 22_KI270731v1_random:85259-85281 GGGTCCTGGGGAGCCACGGAAGG + Intergenic
1203263558 22_KI270734v1_random:1012-1034 GGGTCCTGGGGAGCCACGGAAGG - Intergenic
950415857 3:12868858-12868880 GGCTCCAAAGGACCAATGCATGG + Intronic
950612390 3:14134672-14134694 GGCTCCAGGGGTGCAGTGGAAGG + Intronic
952469432 3:33630656-33630678 GTTTCCAAGGGAACAATGGAAGG + Intronic
953316612 3:41933276-41933298 TGGTCCAGAGGACCACTGGCAGG + Intronic
953322891 3:41987990-41988012 GGATCCAGGGAACAAGTGGAGGG - Intergenic
953469052 3:43151325-43151347 AGTTCAAGGGGACAAATGGAAGG + Intergenic
954292147 3:49655374-49655396 GGGTCCCGGGGACCATAGAAGGG - Exonic
955471034 3:59286690-59286712 GGGTCCTGGGCCCCAATGGCAGG - Intergenic
958185842 3:90118173-90118195 GTGTCAAGGGAACCAAAGGAGGG + Intergenic
961099942 3:124190263-124190285 GGGTTCAGGGGAGCAGTGGGGGG - Intronic
961713916 3:128846189-128846211 GGCTCCAAAGGACCCATGGAAGG - Intergenic
962405885 3:135099700-135099722 GGGGCCACAGGACCTATGGAAGG + Intronic
962927090 3:140004933-140004955 GGTCCCAGTGGACCAATAGAAGG - Intronic
966714909 3:183005250-183005272 GTGTCCTGGTGACCACTGGAGGG - Intergenic
967295685 3:187962630-187962652 GGATACAGAGGACAAATGGAAGG + Intergenic
968391841 4:199240-199262 GGGTACAGGGGAACAAAGAAAGG - Intergenic
969478818 4:7436132-7436154 GGTTGCTGGGGACCAGTGGAGGG + Intronic
970206429 4:13659849-13659871 GGGTCTAGGGGCCAAATGCATGG + Intergenic
971026841 4:22597481-22597503 GGTTATAGGGGAGCAATGGAGGG + Intergenic
976112128 4:81687025-81687047 TGGACCAGTGGAACAATGGATGG - Intronic
977284473 4:95085266-95085288 GGATCCAGCAGACCAATGGCAGG + Intronic
978760034 4:112347011-112347033 AAGTCCAGAGGACCAATGAAGGG - Intronic
981088493 4:140708571-140708593 CTGGCCAGGGGACCAAGGGAGGG + Intronic
982090380 4:151875344-151875366 GGGGCCAGGGGTCCTATGGCAGG + Intergenic
993065302 5:83090585-83090607 GGGTGCATGGGAGGAATGGAGGG + Intronic
993904013 5:93603952-93603974 GGGGCAAGGGGGCCAGTGGAGGG - Intergenic
996113459 5:119592368-119592390 GTGTCCAGAAGACCTATGGAAGG - Intronic
997235335 5:132269233-132269255 GGGTGCAGGGGTCCACTGCAGGG - Intronic
999339700 5:150759336-150759358 GCATCCAGGAGACAAATGGAAGG + Intergenic
1001443409 5:171763594-171763616 GGGTCCAGGGGAGCAGAGCAAGG + Intergenic
1002325761 5:178404580-178404602 AGGTCCCAGGGACCAATGGAGGG - Intronic
1002569174 5:180130286-180130308 GGGGGCAGGGGGCCCATGGAAGG + Intronic
1003647031 6:7921170-7921192 GGGTCCAGGTGGCTAATGGTGGG + Intronic
1007700230 6:43762063-43762085 AGGTCCAGGGGACCAAGTAAGGG - Intergenic
1011191491 6:84734158-84734180 GGGTCCAGGGGAGAAAGGCAAGG - Exonic
1011429944 6:87274887-87274909 GGATCCAGGAGACCTATGGGTGG - Intergenic
1014689921 6:124550723-124550745 GGTTCCAGGGCACAAGTGGAGGG + Intronic
1019342172 7:513461-513483 GGGACCAGGGGGCCAAGGCAAGG - Intronic
1026625050 7:71984633-71984655 GGGTACAGGAGACCCATGGCAGG + Intronic
1026780501 7:73263470-73263492 GGGTCCAGGGACACAGTGGATGG - Intergenic
1027021360 7:74816911-74816933 GGGTCCAGGGACACAGTGGATGG - Intronic
1027066666 7:75129026-75129048 GGGTCCAGGGACACAGTGGATGG + Intronic
1029424271 7:100486659-100486681 AGGTCCAGGGCACCAATGAAGGG - Intronic
1032369063 7:131328051-131328073 TGGGCCAGGGGTGCAATGGAGGG + Intronic
1035644830 8:1210781-1210803 GGGCCCAGGGGAGCTGTGGAAGG - Intergenic
1044591278 8:93916715-93916737 GGGCCCGGGGAACCAATGGGCGG + Intronic
1049344903 8:142133631-142133653 GAGTCCAGGGGAGCCATAGAAGG + Intergenic
1049397049 8:142405750-142405772 GGCTGCAGGGGAGCAAGGGATGG - Intergenic
1051600065 9:18863586-18863608 GGGTCCAGCTGACAAATGGAGGG + Intronic
1055407173 9:75987310-75987332 GGGTCCAAGAGACCAGAGGAGGG - Intronic
1056304972 9:85281448-85281470 GGGTCAAGTTCACCAATGGAAGG - Intergenic
1057274188 9:93667585-93667607 GGGCCCAGGGGCACCATGGAGGG - Intronic
1059557251 9:115293579-115293601 GGGTCCAGGTTCCCAGTGGAAGG - Intronic
1060991991 9:127854586-127854608 GGGTGCTGGGCTCCAATGGATGG + Exonic
1062096522 9:134706675-134706697 GGATCCCGGGGACCAGTGGCAGG + Intronic
1185753695 X:2635302-2635324 GGGGCCTGGATACCAATGGAAGG + Intergenic
1185760629 X:2687811-2687833 GGGTGCAGGTGACCTAGGGAGGG + Intergenic
1187297034 X:18012078-18012100 GGGTCCAGCAGACCAATAGAGGG + Intergenic
1188024181 X:25191513-25191535 AGATGCAGGGGACCAAAGGAGGG + Intergenic
1188981832 X:36733713-36733735 GGGTGCAGGCTACCAATGGGAGG - Intergenic
1190789072 X:53683099-53683121 GCGCCAAGGGGACCAATGGAAGG + Intronic
1195384905 X:104304945-104304967 GGGACCAGGAGAACACTGGAGGG - Intergenic
1199991279 X:152988973-152988995 GGATCCTGGGGCCCTATGGAAGG - Exonic
1202095718 Y:21246633-21246655 GGAGAGAGGGGACCAATGGATGG - Intergenic