ID: 1185342556

View in Genome Browser
Species Human (GRCh38)
Location 22:50298186-50298208
Sequence TGTCCCCGCAGGTCACCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185342548_1185342556 21 Left 1185342548 22:50298142-50298164 CCGGGAAGGGGTGGTGACATGCA 0: 1
1: 0
2: 0
3: 24
4: 213
Right 1185342556 22:50298186-50298208 TGTCCCCGCAGGTCACCCCCAGG 0: 1
1: 0
2: 1
3: 15
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185342556 Original CRISPR TGTCCCCGCAGGTCACCCCC AGG Intronic
900430952 1:2603051-2603073 TGTCCCCGCAGGCCAGCCCTGGG + Intronic
900795165 1:4703380-4703402 TGTCCCCCCGAGTCACCACCAGG - Intronic
901459525 1:9383275-9383297 GGTCCCCGCAGGTCCCCCCTGGG - Intergenic
901669888 1:10849983-10850005 TGCCCCAGCAGGACACCCCAGGG + Intergenic
903173641 1:21568477-21568499 TGTCCACGCAGGTTATTCCCTGG - Intronic
904970833 1:34418344-34418366 TGTCCCCTCTGGGAACCCCCTGG + Intergenic
905121328 1:35684306-35684328 TGTCCTCTGAGGTCACACCCAGG + Intergenic
918042454 1:180921587-180921609 TGCCCCCACAGGCCACCCCTTGG + Intronic
918123942 1:181565880-181565902 TCTCTCCGCAGGTACCCCCCAGG - Intronic
920180686 1:204130198-204130220 TGACCCCACAGGTGACCCCAGGG + Intergenic
920646330 1:207806770-207806792 TGTCCCCCCAGCTCATCCCAGGG - Intergenic
1063100256 10:2944353-2944375 TGTCCCCGCCGGACACCACCAGG - Intergenic
1065101636 10:22336721-22336743 TGTCACCGAAGGCAACCCCCAGG - Intergenic
1067066623 10:43107413-43107435 TGACCCCGCAGGCCAAGCCCTGG - Intronic
1067336868 10:45373840-45373862 AGTCCCCGCAGCTCCACCCCAGG + Intergenic
1067616939 10:47763664-47763686 TGTCCTCTCTGGTCACCCCTCGG + Intergenic
1071329560 10:84546320-84546342 TGCTCATGCAGGTCACCCCCAGG - Intergenic
1076825405 10:132964804-132964826 TGTGAGCCCAGGTCACCCCCAGG + Intergenic
1076912994 10:133401707-133401729 TGTCCCCGCTGAGCACCCCCGGG + Intronic
1077140746 11:1023817-1023839 TGGCCCCGCAGGGCACAGCCCGG + Intronic
1080595844 11:33774048-33774070 TGGCCCCGCAGGTGCCCGCCCGG - Intronic
1083654171 11:64221005-64221027 TGGTCCCGCAGCTCACCCCACGG + Exonic
1084096968 11:66917855-66917877 TTTCCCTGCAGCTCACCCCAGGG - Intronic
1084575494 11:69985822-69985844 GGTGTCCGCAGGTAACCCCCGGG + Intergenic
1089561656 11:119346240-119346262 TCCTCCCCCAGGTCACCCCCTGG + Intronic
1089869809 11:121662425-121662447 TGTCCCTGCCCCTCACCCCCAGG + Intergenic
1091675485 12:2486093-2486115 TGTCCCCGCAGGTCTCCAGGTGG + Exonic
1091979387 12:4853203-4853225 TGGCCCCGCAGGCCAGCCTCTGG - Intergenic
1099641089 12:85285411-85285433 TGTCTCCGCAGATGAGCCCCAGG - Intronic
1103061221 12:117860275-117860297 GGGCCCCCCAGGTCACCTCCAGG + Exonic
1103716390 12:122947707-122947729 TGTCCCCTCTGGCCACCCCACGG - Intronic
1113681188 13:112246165-112246187 AGTCCCCTCAGTGCACCCCCGGG + Intergenic
1114648533 14:24268982-24269004 TCTCCCCGCAGCTGACCCCCAGG - Exonic
1117338559 14:54775194-54775216 TGTCCCCCCAGGTGACCCCAGGG + Intronic
1119566312 14:75632039-75632061 TCTCCCAGCAGTTCACCCCAGGG - Intronic
1120467838 14:84884491-84884513 TGCCCCCGCAGGTCACAGCGTGG + Intergenic
1122964720 14:105117230-105117252 TGTGCCCTCAGGTCAGCCTCAGG - Intergenic
1202832987 14_GL000009v2_random:57374-57396 TGTGCCCGGAGGTCAGGCCCTGG - Intergenic
1124552560 15:30695111-30695133 TGTCCTCCCAGGTCTCCCTCTGG + Intronic
1124678681 15:31710555-31710577 TGTCCTCCCAGGTCTCCCTCTGG - Intronic
1132089168 15:98933809-98933831 TGTCCACGCTGGGCACCACCGGG + Intronic
1132207635 15:99997510-99997532 GGTACACGCAGGTCACCTCCCGG + Exonic
1132325348 15:100964214-100964236 TATCACCGCAGATCACCCCGGGG + Intronic
1132462222 16:61323-61345 TGCCCCCGCCGGGCACCTCCAGG + Intronic
1132646663 16:1002354-1002376 TGAGCCCTCAGGTCACCACCAGG - Intergenic
1136499707 16:30664313-30664335 CGTCCGCGCAGCTCACCCACCGG + Exonic
1137731504 16:50693682-50693704 TCTCCCCCCAGCCCACCCCCAGG - Intronic
1138561381 16:57802626-57802648 CGCCCCCGCAGGTCTCCCGCCGG + Intronic
1139766883 16:69238080-69238102 TGTCCACGCAGGTCAGCGTCCGG - Intronic
1142303770 16:89274377-89274399 TGTCCCCGTATGACAGCCCCTGG + Intronic
1142372463 16:89690754-89690776 TGGCCCAGCACATCACCCCCAGG + Intronic
1142379141 16:89721796-89721818 CGTCCCCGCAGGACCCCACCGGG - Exonic
1143857488 17:9862983-9863005 TTTCCCTCCAGGTCACACCCAGG - Intronic
1145939890 17:28737808-28737830 TGTACCTGCAGGTATCCCCCGGG + Exonic
1146062067 17:29612876-29612898 CCTCCCCGCAGGTCACCATCTGG + Exonic
1148593088 17:48831185-48831207 TCTCACCGCAGTTCACCCTCTGG + Intronic
1150930670 17:69581411-69581433 TTTCCCAGCAGTTCACCTCCGGG - Intergenic
1151307777 17:73274514-73274536 TGTCCCCGCCATTCACCTCCCGG + Intergenic
1152847807 17:82613375-82613397 TGTCCCCGCAAGACATCCCAGGG + Intronic
1155199429 18:23503894-23503916 TGTCCTCGCAGGTGACCTCGGGG + Intronic
1157550351 18:48576990-48577012 TGTCCCCGCAGATCATCCCAGGG - Intronic
1160242285 18:77132560-77132582 CGTCCCCGAGGGTCACCCACCGG + Exonic
1160875750 19:1295534-1295556 TGTCCCCGCAGGTTCCACGCAGG + Exonic
1162799408 19:13102720-13102742 TCTCCGCGTAGGTCCCCCCCAGG + Exonic
1163665072 19:18599456-18599478 TGTGCCCACAGCTCATCCCCAGG + Intronic
1163860076 19:19738174-19738196 TGCGCCCGCAGGCCAGCCCCTGG - Intergenic
1164857895 19:31539116-31539138 TGTCCCCACATGTAAGCCCCAGG + Intergenic
1165353634 19:35290975-35290997 TTTCCCCGCCCCTCACCCCCTGG + Intergenic
1165885714 19:39076748-39076770 TGTCTCAGCAGGTCCCTCCCTGG - Intergenic
1166741525 19:45117603-45117625 TCTCCCTGCAGGTCCCCACCAGG + Intronic
1167485956 19:49763118-49763140 TGGCCCGGCTGGTCACCCTCCGG + Exonic
1167693806 19:51002583-51002605 TTTCCCCCCAGGTCTCCGCCAGG + Exonic
1168145772 19:54419370-54419392 TGTCCCCGGAGGACACCCCCAGG - Intronic
1168685703 19:58347850-58347872 TGTCCCCGCACCCCTCCCCCAGG + Intronic
928170421 2:28999577-28999599 TGTACCCACCGATCACCCCCAGG - Intronic
928606431 2:32947867-32947889 TGACCCCGCAGGTCCCTCCGCGG - Intronic
932570361 2:72935306-72935328 TGTCACCTCTGGCCACCCCCAGG + Intronic
937241351 2:120464593-120464615 TCTCCCTCCAGGTCACCTCCAGG + Intergenic
937286276 2:120754431-120754453 TGTCCCCCCACCCCACCCCCTGG + Intronic
940446278 2:153781956-153781978 TGTCCACGCAGGTCACAACATGG - Intergenic
943770467 2:191710835-191710857 TGACCTGGTAGGTCACCCCCAGG - Intergenic
948145885 2:235707785-235707807 TGTCCCACCAGGTCACACGCTGG - Intronic
1170549572 20:17465326-17465348 TGTCCCGCCAGGTCAGACCCAGG - Exonic
1172428388 20:34871766-34871788 TGTCCCTGCACGTCACTTCCTGG - Intronic
1172474417 20:35226589-35226611 TGCCCTCGCAGGTCCCGCCCGGG + Intergenic
1173799640 20:45886970-45886992 AGTCCCCCCAGGGCAGCCCCTGG + Exonic
1174420531 20:50396443-50396465 TGTCCCAGAAGGTAACCTCCTGG + Intergenic
1175813944 20:61873942-61873964 GGTCCCCGCAGGACACCCACAGG + Intronic
1176122436 20:63460201-63460223 TGACCCTGCAGGTCCCTCCCTGG + Intronic
1176214383 20:63941349-63941371 TCTCCCCCCAGCTCAGCCCCAGG - Intronic
1176411332 21:6451004-6451026 AGTCCCCGCAGGGCCCCACCGGG + Intergenic
1179085384 21:38212049-38212071 TGTCCCACCAGGTCCCTCCCTGG - Intronic
1179686825 21:43059326-43059348 AGTCCCCGCAGGGCCCCACCGGG + Intronic
1180038089 21:45260798-45260820 TGTCCACGCAAGTCATACCCTGG + Intergenic
1180090532 21:45531593-45531615 AGTCCCCACAGGCCACCCGCAGG + Exonic
1181433231 22:22895364-22895386 TGTCCACACAGGTCAGCCCAAGG + Exonic
1181541052 22:23573574-23573596 TGTCCACACAGGTCAGCCCAAGG - Exonic
1181603706 22:23967237-23967259 GGTCCCTGAAGGTCACGCCCGGG - Intronic
1181604807 22:23974070-23974092 GGTCCCTGAAGGTCACGCCCGGG + Intronic
1181797329 22:25319756-25319778 TGTCCACACAGGTCAGCCCAAGG + Intergenic
1185342556 22:50298186-50298208 TGTCCCCGCAGGTCACCCCCAGG + Intronic
1185377063 22:50487541-50487563 AGTTCCCACAGGGCACCCCCTGG - Intronic
950533203 3:13565088-13565110 TGTCCCTGCTGGACACTCCCTGG + Intronic
953872767 3:46641849-46641871 TGTCCTGTCAGGTCACCACCAGG + Intergenic
955139616 3:56256191-56256213 TGTCTCTGCAGGTCTCCTCCTGG - Intronic
960055368 3:113273093-113273115 TATCCCAGCTGGTCATCCCCTGG + Exonic
961736247 3:129003783-129003805 TGTCCCCGCAGGTCGGACTCTGG + Exonic
965251846 3:166352433-166352455 TTTCCTAGCAGGTCAACCCCTGG + Intergenic
966938530 3:184730465-184730487 TGGCCCCCCAAGTCACCTCCAGG - Intergenic
967896152 3:194397418-194397440 TCTCCCCGAAGAGCACCCCCGGG + Exonic
968461375 4:726885-726907 GGTCCCCGCAGGCCTCCCTCAGG + Intronic
968741112 4:2332213-2332235 GGACCCCCCAGGTGACCCCCAGG - Intronic
968941812 4:3642987-3643009 TGTCCCAGCAGGAGACCACCCGG - Intergenic
969216120 4:5723707-5723729 TGACCTCACAGGTCACACCCAGG - Intronic
969619074 4:8269910-8269932 TGTCCCCGCCGGCCCCCGCCCGG + Exonic
970173298 4:13310328-13310350 TGTCCCCTTAGCTCACCTCCAGG - Intergenic
985619643 5:947476-947498 CAGCCCCGCAGGTCACACCCCGG + Intergenic
991524213 5:67538286-67538308 TGGCCCTGCAGCTCATCCCCAGG - Intergenic
993727040 5:91380567-91380589 TGTCCCCTCAGGTCAACTCAAGG + Intronic
995566342 5:113435555-113435577 TGTCCACACAGGTGACCCTCAGG + Intronic
997179396 5:131812807-131812829 GGTCCCTGCAGGTGACTCCCAGG + Intronic
997583952 5:135033938-135033960 TGTCCCCGCAGGTCGCAGCCAGG - Exonic
998136508 5:139677000-139677022 TGTCCCCGCCCGTCAGCCCCTGG + Intronic
1002793085 6:449599-449621 TGTCCGCGCTGGCCACGCCCAGG - Intergenic
1004134982 6:12957599-12957621 AGTACCCGCAGGTCACACCCAGG + Intronic
1005876137 6:30011140-30011162 TGTCCCCACAGCCCACCCTCTGG - Intergenic
1007496085 6:42261038-42261060 TATCCCCGCGCCTCACCCCCAGG + Intronic
1017724449 6:157267428-157267450 TGTTCCCGCACATCACTCCCTGG + Intergenic
1017969497 6:159299440-159299462 TGTCCCCACAGGACAGCACCAGG + Intergenic
1019276541 7:178793-178815 TGCCCCCGCAAGACACCTCCTGG - Intergenic
1019517939 7:1447862-1447884 TGGGCCCCCAGGTCCCCCCCGGG - Intronic
1023473610 7:40552473-40552495 TGTCCTCGCAGGCCATCACCAGG - Intronic
1024256008 7:47540444-47540466 TGGCCCCTCAGCTCTCCCCCAGG - Intronic
1029116663 7:98241173-98241195 GGTCCCTGCTGGACACCCCCGGG - Exonic
1029927057 7:104329034-104329056 TGCCCCTGCAGGTCAGCTCCCGG - Exonic
1031582797 7:123498048-123498070 TGTCCCAGAAGGTGACACCCAGG + Intronic
1034335974 7:150323624-150323646 TGGCCCAGCAGGTGGCCCCCCGG - Intronic
1034465637 7:151226984-151227006 TCTCCACGCTCGTCACCCCCGGG + Intronic
1035782660 8:2240771-2240793 TGTCCCAGCAGGTCACTCGCCGG + Intergenic
1035809460 8:2478818-2478840 TGTCGCAGCAGGTCACTCGCTGG - Intergenic
1037513197 8:19604235-19604257 TATACCTGCAGGTCACCTCCTGG - Intronic
1037928709 8:22865056-22865078 TGGCCCTGCAGGTCCCCGCCTGG - Intronic
1038010197 8:23469472-23469494 TGTACACACAGGTCACTCCCAGG - Intergenic
1043446970 8:80328648-80328670 TGTTCCAGCAGGCCACCCCAAGG + Intergenic
1053455902 9:38233035-38233057 TGTCCCTGCAGGACATACCCAGG + Intergenic
1055728629 9:79258162-79258184 TGTCCACGCAGCACAGCCCCAGG - Intergenic
1059769574 9:117413752-117413774 TGTCCTTGCAGCTCACTCCCTGG - Intronic
1059959739 9:119553321-119553343 AGCCCCAGCAGGTCACCACCTGG + Intergenic
1060146938 9:121261139-121261161 TGTCCCCGCAGGCCACCAGTGGG - Intronic
1062249556 9:135587407-135587429 TGTCCCCGCGTGTCACTCCCGGG - Intergenic
1062297694 9:135841613-135841635 TGTCCCAGAAGGGCACCCTCCGG - Intronic
1062368616 9:136224500-136224522 AGACCCCGCAGGCCACACCCTGG - Intronic
1062396866 9:136356111-136356133 TGTCTCCTCCTGTCACCCCCTGG + Intronic
1062451662 9:136618284-136618306 TGGCCCCCCAGGCCTCCCCCAGG - Intergenic
1186493471 X:9993107-9993129 TGTCCCGGCAGGAAACCCCCCGG - Intergenic
1186669898 X:11758030-11758052 CGTCCCCGCACGTCCCCGCCGGG - Intergenic
1188885740 X:35546996-35547018 TGACCCAGCAGGTCACCCTCTGG - Intergenic