ID: 1185343249

View in Genome Browser
Species Human (GRCh38)
Location 22:50300725-50300747
Sequence ACCCAGAGCCCAGACTGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 398}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185343249_1185343256 4 Left 1185343249 22:50300725-50300747 CCCCTGCAGTCTGGGCTCTGGGT 0: 1
1: 0
2: 6
3: 36
4: 398
Right 1185343256 22:50300752-50300774 GCAGGAAAAGTCACCCTGGCTGG 0: 1
1: 0
2: 1
3: 22
4: 158
1185343249_1185343258 16 Left 1185343249 22:50300725-50300747 CCCCTGCAGTCTGGGCTCTGGGT 0: 1
1: 0
2: 6
3: 36
4: 398
Right 1185343258 22:50300764-50300786 ACCCTGGCTGGTGGCAGTGATGG 0: 1
1: 0
2: 6
3: 40
4: 333
1185343249_1185343257 7 Left 1185343249 22:50300725-50300747 CCCCTGCAGTCTGGGCTCTGGGT 0: 1
1: 0
2: 6
3: 36
4: 398
Right 1185343257 22:50300755-50300777 GGAAAAGTCACCCTGGCTGGTGG 0: 1
1: 0
2: 0
3: 34
4: 290
1185343249_1185343254 0 Left 1185343249 22:50300725-50300747 CCCCTGCAGTCTGGGCTCTGGGT 0: 1
1: 0
2: 6
3: 36
4: 398
Right 1185343254 22:50300748-50300770 CCCAGCAGGAAAAGTCACCCTGG 0: 1
1: 0
2: 0
3: 14
4: 212
1185343249_1185343262 18 Left 1185343249 22:50300725-50300747 CCCCTGCAGTCTGGGCTCTGGGT 0: 1
1: 0
2: 6
3: 36
4: 398
Right 1185343262 22:50300766-50300788 CCTGGCTGGTGGCAGTGATGGGG 0: 1
1: 0
2: 6
3: 43
4: 421
1185343249_1185343260 17 Left 1185343249 22:50300725-50300747 CCCCTGCAGTCTGGGCTCTGGGT 0: 1
1: 0
2: 6
3: 36
4: 398
Right 1185343260 22:50300765-50300787 CCCTGGCTGGTGGCAGTGATGGG 0: 1
1: 0
2: 6
3: 41
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185343249 Original CRISPR ACCCAGAGCCCAGACTGCAG GGG (reversed) Intronic
900086508 1:900484-900506 ACCCAGAGTCAAGTGTGCAGAGG - Intergenic
900180957 1:1310743-1310765 ACCCAGAGCCAAGACTGCACAGG - Intronic
900209068 1:1444638-1444660 ACCCAGGACCGAGGCTGCAGTGG - Intergenic
900218903 1:1496556-1496578 ACCCAGGACCGAGGCTGCAGTGG - Intronic
900530625 1:3151273-3151295 CCCCAGAGTCCAGACAGAAGTGG + Intronic
900641906 1:3691592-3691614 CCCCAGGGCTCAGGCTGCAGGGG - Intronic
900985966 1:6072926-6072948 ACCCAGAGCCCAGGATTCAGGGG + Intronic
901018672 1:6245308-6245330 AGCAGGAGCCCAGACGGCAGGGG - Exonic
901817210 1:11801122-11801144 AGCCAGAACCCAGAGTGTAGGGG + Intronic
901873117 1:12150082-12150104 TCACAGAGCCCAGACTCAAGGGG + Intergenic
902447534 1:16476562-16476584 GCTCAGAGCCCAGGCTGCAGCGG + Intergenic
902467434 1:16626777-16626799 GCTCAGAGCCCAGGCTGCAGCGG + Intergenic
902507149 1:16945958-16945980 GCTCAGAGCCCAGGCTGCAGCGG - Intronic
903266523 1:22161201-22161223 ACCCAGAGCCCAGACCACCCCGG + Intergenic
903354268 1:22736717-22736739 ACCCCGGGCCCAGCCTGCAATGG + Intronic
904285067 1:29448717-29448739 ACCCAGAGCCCTGACCTGAGAGG - Intergenic
905430129 1:37916379-37916401 AGAAAAAGCCCAGACTGCAGTGG - Intronic
905816247 1:40953170-40953192 ACCCAGACCCCACTCCGCAGTGG - Intergenic
906041268 1:42789453-42789475 CCCCATGGCCCAGAATGCAGGGG - Intronic
906608225 1:47185538-47185560 AGGGAGAGCCCACACTGCAGGGG - Intronic
906865695 1:49417029-49417051 ACCCAGAACACAGAATACAGTGG - Intronic
907296137 1:53456099-53456121 AACCTGAGCCCAGAAGGCAGAGG + Intergenic
907961234 1:59283678-59283700 ACCCAAAGACCAGACTGCCCAGG + Intergenic
908403169 1:63789756-63789778 ACCCAGATCTCACAGTGCAGAGG - Intronic
909908843 1:81235280-81235302 ACCCAGGGGCTAGAGTGCAGTGG - Intergenic
910161304 1:84275614-84275636 AGCCAGAGCCTAAACTTCAGGGG - Intergenic
911044580 1:93617831-93617853 CCACAGAGCCGAGTCTGCAGAGG - Intronic
912273804 1:108236013-108236035 ACCCTGCACCCAGGCTGCAGAGG + Intronic
912294415 1:108458310-108458332 ACCCTGCACCCAGGCTGCAGAGG - Intronic
913610484 1:120505430-120505452 ACAAAGAGGCCAGGCTGCAGAGG + Intergenic
913986101 1:143567565-143567587 ACCAACATCCCAGACTGGAGGGG - Intergenic
915253747 1:154609481-154609503 AGACAGAGCCCAGCCTGCAAGGG - Intronic
915701627 1:157802137-157802159 TCCCAGGGCCCAGGCTGCAGTGG - Exonic
919760721 1:201096404-201096426 AGACTGAGCCCAGGCTGCAGAGG - Intronic
921092205 1:211855009-211855031 GCCCAGCGGCCAGACTCCAGGGG - Intergenic
922215516 1:223516531-223516553 ACCCAGAACCCAGACAACAATGG - Intergenic
923502380 1:234576307-234576329 GGCCAGGGCCCAGGCTGCAGAGG - Intergenic
923554182 1:234987705-234987727 GCCCAGAGATCAGACTGCACAGG + Intergenic
1062965186 10:1601738-1601760 CCCCGGAGCACAGACCGCAGCGG - Intronic
1063555129 10:7071628-7071650 ACCCAGTCCCCAGACAGCAAGGG + Intergenic
1064705323 10:18066952-18066974 AATCAGAGCCCAGGCTGCTGGGG - Intergenic
1067427701 10:46222096-46222118 ACCCAGTGTCCAGCCTGCATGGG + Intergenic
1068032542 10:51721172-51721194 ACCCAGAGGCTGGAGTGCAGTGG - Intronic
1068868362 10:61918110-61918132 AGACTGAGGCCAGACTGCAGGGG + Intronic
1068989976 10:63140096-63140118 ACCCAGAGGCTGGAATGCAGTGG - Intronic
1069572800 10:69504609-69504631 ACCCAGAGCCAGGACTGCTGTGG + Intronic
1069719387 10:70539819-70539841 TCCCAGAGCCCAGACCAGAGGGG - Intronic
1069933462 10:71899514-71899536 ACCCAAAGCCAAGACAGCAATGG + Intergenic
1071048337 10:81413170-81413192 ACCAATAGCACAGACTGCAAAGG - Intergenic
1071450227 10:85786833-85786855 TCCCAGGGCCCAGGCTGCAAAGG + Intronic
1071478964 10:86048632-86048654 ACCCAGAACCCTGGCTCCAGAGG - Intronic
1071561946 10:86651931-86651953 ACCCTGAGCCAAGCTTGCAGAGG + Intergenic
1072754867 10:98012671-98012693 ACCCAGAGACCAAAATGAAGGGG + Intronic
1072972131 10:100026629-100026651 ATCCAGACCCCAGAATCCAGAGG - Intergenic
1074461276 10:113639299-113639321 ACCCAGTGCCCAGACATCAGAGG - Intronic
1075072355 10:119327488-119327510 ACCCCGTGCCCAGCCTTCAGTGG - Intronic
1075326531 10:121536727-121536749 AGCAAGAGCCCAGACCGGAGTGG + Intronic
1075612361 10:123864042-123864064 AGCCAGAGCCCAGGCTCCTGGGG - Intronic
1076027382 10:127126992-127127014 ACCCAAAGGCCAGCCTCCAGTGG + Intronic
1077045110 11:541235-541257 ACCCAGAGCCCGGACCGCGCCGG - Intronic
1077240210 11:1506829-1506851 TCCCACAGCCCAGTCAGCAGAGG + Intergenic
1077260946 11:1619995-1620017 ACACAGAGCCCAGAATGGGGTGG - Intergenic
1078079427 11:8193158-8193180 ACCCTGGACACAGACTGCAGTGG - Intergenic
1080383237 11:31795837-31795859 ACCCAGGACCCAGCCTGTAGTGG - Intronic
1082804521 11:57439201-57439223 GCCAAGAGGCCAGAGTGCAGTGG + Intergenic
1083789393 11:64974681-64974703 TCCCCCAGGCCAGACTGCAGTGG - Intergenic
1084558983 11:69892184-69892206 ACCGAGAGTCCAGACCCCAGAGG + Intergenic
1088652722 11:111972645-111972667 AGGCAGAGCCCAGAATGCAGGGG - Intronic
1089737634 11:120561149-120561171 ACCCAGAGACCACACACCAGGGG - Intronic
1090028366 11:123186557-123186579 ACCCAGAGGCTGGAATGCAGTGG + Intronic
1090925937 11:131250564-131250586 CTCCAAAGCCCAGTCTGCAGTGG + Intergenic
1091209707 11:133845628-133845650 ACCCAGAGCCTGAAATGCAGGGG - Intergenic
1091227438 11:133966094-133966116 ATCCAGAGCCCTGACTGGGGAGG + Intergenic
1091267560 11:134282673-134282695 GCCCCCAGCCCAGACTGCTGAGG + Intronic
1091550572 12:1532003-1532025 ACGGAGAGCCCAGGCAGCAGCGG + Intronic
1092210135 12:6640421-6640443 ACTCAGAGGCCAGCCTGCAGCGG - Exonic
1095951345 12:47783565-47783587 AGCCAGGGCCCATACTGGAGGGG + Exonic
1096024545 12:48350152-48350174 CCCTAGAACCCACACTGCAGTGG - Exonic
1096909092 12:54963883-54963905 GGCCAAAGCCCAGACTGAAGAGG + Exonic
1097889273 12:64760510-64760532 TCCCTGAGGCCAGAGTGCAGTGG - Intergenic
1098838685 12:75452827-75452849 AACCAGAGCCTAACCTGCAGGGG - Intergenic
1100331670 12:93588654-93588676 GCCCAGAGACTAGACTGCAATGG + Intergenic
1100930769 12:99607204-99607226 TCCCAGACCCCAGAATCCAGAGG + Intronic
1101418382 12:104528537-104528559 ACCCAGTCCCCAAGCTGCAGGGG - Intronic
1102226350 12:111230945-111230967 CCTCAGAGCACAGACAGCAGTGG + Intronic
1102240304 12:111320792-111320814 TCCCAGAGCCCAGACACCGGGGG - Intronic
1104259584 12:127170538-127170560 ACCCAGAGACCAGACCCCTGGGG - Intergenic
1105325299 13:19365171-19365193 TCCCCCAGGCCAGACTGCAGTGG - Intergenic
1105699800 13:22927137-22927159 ACCCCGAGCCCAGGCTGCCAGGG + Intergenic
1106752693 13:32791315-32791337 AGGCAGAAGCCAGACTGCAGTGG + Intergenic
1106974394 13:35189974-35189996 AACCAGAGGCCAGACACCAGTGG + Intronic
1107014433 13:35697000-35697022 AGCCAGAGCCCAGGCTGCCCTGG + Intergenic
1109598300 13:64587591-64587613 TCCCATAGGCCAGAGTGCAGTGG + Intergenic
1111648228 13:91058406-91058428 ACCCAGACCCCAGATTCTAGAGG + Intergenic
1112041682 13:95553324-95553346 ACCCAGAGTTCATGCTGCAGGGG + Intronic
1113380987 13:109806172-109806194 ACAGAGAGCCCAGATTCCAGGGG - Intergenic
1113420208 13:110165229-110165251 TCCCAGAGCCCAGAATGCAGTGG - Intronic
1113779004 13:112965348-112965370 GCCCAGAGCTCATGCTGCAGCGG - Intronic
1115780875 14:36766624-36766646 ACCCAGAGGCCAGAAAGCACGGG - Intronic
1118738810 14:68723157-68723179 CCCCACAGCCCAGAACGCAGTGG + Intronic
1119598528 14:75958473-75958495 ACCCAGAGGGCAGACAGGAGAGG + Exonic
1120100475 14:80439180-80439202 ACACAGACCCTAGACTGAAGGGG + Intergenic
1121629874 14:95414181-95414203 CCCCAAAGCCCAGGCTGGAGGGG - Intronic
1121719408 14:96098737-96098759 AGCCAGAGGGCAGGCTGCAGGGG - Intergenic
1121816471 14:96932741-96932763 TTCCAGATCCCAGACTGCCGGGG - Intergenic
1122124214 14:99570497-99570519 AGGCAGAGCCCAGACGGCAGGGG + Intronic
1122840922 14:104462145-104462167 ACCCCGAGCCCAGGCTGCCAGGG + Intergenic
1123102684 14:105816304-105816326 GGCCAGAGGCCAGACTGCATGGG - Intergenic
1123115382 14:105892065-105892087 ACCCAGGCCCAGGACTGCAGTGG + Intergenic
1123119635 14:105910783-105910805 ACCCAGGCCCAGGACTGCAGTGG + Intergenic
1124239480 15:28017859-28017881 GCCCAGAGCCTAGACTCCAGAGG - Intronic
1124379294 15:29151269-29151291 ACCCTGAGCTCATACTCCAGAGG - Intronic
1125547426 15:40516664-40516686 GCCCAGATCCCAGAATGGAGAGG - Intergenic
1125647398 15:41284037-41284059 GCCCAGAGGCCAGTTTGCAGCGG - Intergenic
1125724191 15:41859924-41859946 AGCCAGATCCCAGACTGGTGGGG - Intronic
1126308896 15:47293223-47293245 ACCCAGAGCCCAGTGTGATGAGG - Intronic
1127308740 15:57732494-57732516 ATCCAGAGCCCAAACAGAAGAGG + Intronic
1127453282 15:59136887-59136909 ACGCTAAGCCCAGTCTGCAGAGG + Exonic
1127643833 15:60940483-60940505 AGCCAGAGGCCAGGTTGCAGGGG + Intronic
1128590703 15:68894325-68894347 AACCAGAGCCCAACCTGCTGGGG - Intronic
1129241776 15:74256221-74256243 ACACAGAGCCCAGCCTCCTGAGG - Intronic
1129931831 15:79417680-79417702 GCGAAGAGCCCACACTGCAGAGG - Intronic
1130101030 15:80894165-80894187 ACCCAGAGCCCACCATGCGGTGG + Intronic
1132262016 15:100434019-100434041 CCACAGAGGCCTGACTGCAGGGG - Intronic
1132406352 15:101543681-101543703 ACCAAGACCCCAGACTGCCTAGG + Intergenic
1132596149 16:751238-751260 TCCCACAGCCCTGACTGCACAGG + Intronic
1132856315 16:2046504-2046526 CCACATACCCCAGACTGCAGAGG - Intronic
1133610574 16:7429572-7429594 ACCCAGAGCCTAGAATCTAGAGG + Intronic
1135513715 16:23111677-23111699 AGCCAGAGGACAGAATGCAGAGG + Intronic
1135752273 16:25066917-25066939 CTCCAGCGCCCAGACTGTAGCGG - Intergenic
1136497103 16:30651363-30651385 CGCCAGAACCCAGAATGCAGCGG - Exonic
1136550992 16:30982561-30982583 ACAGAGAGCCCAGACCGCACGGG + Intronic
1136676466 16:31913108-31913130 ACACAAAGCCCAGACTGCGAAGG - Intronic
1137605235 16:49782756-49782778 TCCCAGAACCCAGCCTGGAGAGG + Intronic
1138317195 16:56080613-56080635 TCACCGAGGCCAGACTGCAGTGG + Intergenic
1138445115 16:57058720-57058742 GCCCAGACCCCAGACCACAGGGG + Intronic
1139967672 16:70754668-70754690 TGCAAGAGCCCAGCCTGCAGGGG - Intronic
1140553369 16:75892439-75892461 ACCCAGAGGCTGGAATGCAGTGG + Intergenic
1140931079 16:79628647-79628669 ACCCAGAGCCCAGCAGCCAGGGG - Intergenic
1141038853 16:80654566-80654588 ACCCAGGGCCCTGTATGCAGAGG - Intronic
1141592850 16:85080095-85080117 ACCCAGAGGGCAGAGGGCAGAGG + Intronic
1141597352 16:85105411-85105433 AGGCAGAGACCAGAGTGCAGAGG - Exonic
1142025720 16:87812433-87812455 ACCCCCAGCCCAGGCTGCTGGGG + Intergenic
1142122722 16:88394985-88395007 GCCCAGATCCCAGAGTGGAGAGG - Intergenic
1142151101 16:88512883-88512905 ACCCAGAGGCCTGGCTCCAGGGG - Intronic
1142239692 16:88939659-88939681 TCCCAACGCCCAGACTGGAGCGG + Intronic
1143049098 17:4107959-4107981 ACACACAAGCCAGACTGCAGGGG + Intronic
1143190372 17:5035651-5035673 GCCCAGAGCCCACACAGCTGGGG + Intronic
1143248255 17:5503469-5503491 ATCCGGAGCTCAGACAGCAGAGG + Intronic
1143730440 17:8879635-8879657 AGGCAGAACCCAGACTGAAGAGG - Exonic
1144569467 17:16387037-16387059 ACCCAGAGGCTTGAGTGCAGCGG - Intergenic
1145361726 17:22217544-22217566 ACCCAGAGGCTTGAGTGCAGGGG - Intergenic
1146226205 17:31068526-31068548 AGCCAGAGCCCATCCTGTAGAGG - Intergenic
1146659901 17:34658805-34658827 ACCCTGAGCCCTGGATGCAGAGG - Intergenic
1147162272 17:38575074-38575096 GCACAGAGCTCATACTGCAGAGG + Intronic
1147667729 17:42159445-42159467 ACCATGAGCCCAGGCTGGAGAGG - Intronic
1148029405 17:44609125-44609147 TCCCAGATCCCAGGCTACAGGGG + Intergenic
1148129748 17:45255663-45255685 CCTCAGAGCACAGCCTGCAGCGG - Exonic
1148240618 17:45997404-45997426 ACACAGAGGGAAGACTGCAGCGG - Intronic
1148728412 17:49813966-49813988 ACCCAGAACCCAGGAGGCAGAGG - Intronic
1149313826 17:55421331-55421353 AGCCAGAGCCCAGCCTGTATGGG + Intronic
1149654299 17:58302279-58302301 TCCCAGAGCCCAGCCTCCTGAGG + Exonic
1149683242 17:58520030-58520052 ACCCAGACCCCAGATAACAGAGG + Intergenic
1150314587 17:64157864-64157886 ACAAAGGGCCCAGACTGCAGTGG + Intronic
1150608868 17:66717200-66717222 ATCCACAGCCCAGACCCCAGCGG + Intronic
1150735122 17:67730298-67730320 GCCCAGAGGCTAGAGTGCAGTGG + Intronic
1151423416 17:74013880-74013902 TCCCTGAGCCCCGATTGCAGGGG - Intergenic
1152495904 17:80671200-80671222 ACGAAGAGCACAGGCTGCAGAGG - Intronic
1153073407 18:1132798-1132820 ACCCAGATCCCAGTCTTCACTGG - Intergenic
1153662743 18:7339911-7339933 ACCCAGAACCCAGAACCCAGTGG + Intergenic
1153839203 18:8990801-8990823 GGCCAGAGCCCAGAGTGCTGAGG + Intergenic
1156339622 18:36199786-36199808 TCCCAGGGCCCAGAGAGCAGTGG + Exonic
1156894082 18:42224576-42224598 ACCCAAAGACCAGTCAGCAGAGG - Intergenic
1157370723 18:47109144-47109166 GCCCAGACCCCAGAGGGCAGAGG + Intronic
1157782750 18:50454556-50454578 ACTCAGAGCCAAGACTGCTCTGG - Intergenic
1157812176 18:50705088-50705110 ACCCATACCCCACACGGCAGAGG + Intronic
1158790434 18:60774403-60774425 ACACAGACCCCAGGCTGAAGTGG + Intergenic
1159008692 18:63038257-63038279 ACCCCCAGCCCAGGCTGGAGTGG - Intergenic
1159960964 18:74555495-74555517 CCCCAGAGCCCTGTCTGGAGTGG - Intronic
1160562398 18:79766812-79766834 TCCAGGAGCCCAGGCTGCAGTGG - Intergenic
1160718201 19:585848-585870 AGCCACAGCCCAGAGTGGAGGGG - Intergenic
1160780843 19:877388-877410 TCCCTGAGCCCCGACTGCACTGG + Intronic
1160803333 19:980233-980255 GCCAAGAGTCCAGACTGGAGAGG + Intergenic
1160945524 19:1641490-1641512 TCCCCGAGGCCAGAGTGCAGTGG + Intronic
1161015341 19:1980316-1980338 AGCCAGAACGCAGACTGCAGGGG + Exonic
1161154262 19:2724004-2724026 AGCCATAGCCCAGCCTGCTGGGG + Intronic
1161167181 19:2794579-2794601 TCCCAGGGCCCAGCCTGGAGGGG + Intronic
1161595987 19:5151220-5151242 ACACAGAGCCCTGATTGCTGTGG - Intronic
1161708624 19:5834464-5834486 ACCCAGTGCCCACACTCCGGGGG - Intronic
1162147710 19:8623067-8623089 ACCCAGAGGCTGGAGTGCAGAGG + Intergenic
1162958798 19:14114238-14114260 CCCCAGAACCCTGCCTGCAGGGG + Intronic
1163171371 19:15533635-15533657 ACCCAGAGGCTGGAGTGCAGTGG + Intronic
1163565883 19:18051241-18051263 ACCCAGAGGCTGGAGTGCAGTGG - Intergenic
1163642515 19:18469671-18469693 ACACAGAGCCCAGGCCACAGGGG + Intronic
1163698689 19:18776505-18776527 ACTCAGAGCCCAGGCCACAGTGG - Intronic
1164160445 19:22622962-22622984 ACCCCAACCCCAGACCGCAGGGG - Intergenic
1164642905 19:29839563-29839585 GCACAGAGCCCAGACTTTAGCGG - Intergenic
1167104292 19:47421190-47421212 CCCCAGCTCCCAGTCTGCAGGGG + Intergenic
925911435 2:8575898-8575920 ACCCAGAGTCCAGACTCCGCGGG + Intergenic
926033230 2:9611708-9611730 ACCCAGAGGCTGGAATGCAGTGG + Intronic
926742458 2:16124169-16124191 ACTCGGAGCTCAGACTCCAGAGG - Intergenic
927062845 2:19440670-19440692 CCCTTGAGCCCAGACTTCAGTGG + Intergenic
927257309 2:21050761-21050783 TGCCAGAGCCCAGACTGCTTAGG + Intergenic
927485076 2:23483174-23483196 ACCCAGAGCACACACTTGAGGGG + Intronic
927872357 2:26631698-26631720 TCCCAGGGCACAGAGTGCAGTGG - Intronic
929447207 2:42010876-42010898 AGCCTGAGGCCACACTGCAGAGG + Intergenic
931055722 2:58468241-58468263 ACCCAGTGCCCAGGCTGTAGGGG + Intergenic
932449443 2:71800236-71800258 CTGCAGAGCCCATACTGCAGGGG + Intergenic
934040915 2:88126829-88126851 CTCCAGAGCCTTGACTGCAGAGG - Intronic
935500504 2:103832308-103832330 ACCAAGAGCCCATTCTGGAGGGG - Intergenic
936153569 2:110034665-110034687 CCCCTGGGCCCAGGCTGCAGCGG + Intergenic
936191112 2:110336750-110336772 CCCCTGGGCCCAGGCTGCAGCGG - Intergenic
937674197 2:124571570-124571592 ACCCACAGGCTAGAGTGCAGTGG + Intronic
938653632 2:133408842-133408864 TCCCAGTGCCCAGACTCCAGTGG - Intronic
939009887 2:136833322-136833344 TCGCCGAGGCCAGACTGCAGTGG - Intronic
939964166 2:148594232-148594254 ACCAAGAGCACAGACTTCAATGG - Intergenic
941433339 2:165437488-165437510 ACCCAGAGGCTGGAGTGCAGTGG + Intergenic
941542505 2:166804256-166804278 AGCCAGAGCCCAGGCTGCCAGGG + Intergenic
943464135 2:188207820-188207842 CACCAGTGCTCAGACTGCAGAGG - Intergenic
945097776 2:206235814-206235836 ACCCAGAGCCCTAGCTGCAAGGG + Intergenic
945196969 2:207245717-207245739 TCCCAGGCCACAGACTGCAGTGG - Intergenic
945654306 2:212604992-212605014 TGTGAGAGCCCAGACTGCAGAGG + Intergenic
946564520 2:220948875-220948897 ACCCAGGCCCTCGACTGCAGAGG - Intergenic
948576491 2:238955049-238955071 GCTCAGGGCCCAGGCTGCAGAGG + Intergenic
948734821 2:239995232-239995254 GCCCATCGCCCAGGCTGCAGTGG - Intronic
948806197 2:240454290-240454312 ACCCACTGCCCAGGCTGCAGAGG - Intronic
1168915169 20:1479501-1479523 TGCCAGAGCCCAGGCTGGAGAGG - Intronic
1169135702 20:3195774-3195796 ACACAGAAGCCAGACTGGAGTGG - Intronic
1170484718 20:16804839-16804861 AACCAGAGCCAAGACTGATGAGG - Intergenic
1170705321 20:18739099-18739121 AGCCTGAGGCCACACTGCAGAGG - Intronic
1170868551 20:20183236-20183258 ACCCAGAACCCAGGAGGCAGAGG - Intronic
1171460795 20:25296883-25296905 GCCCAGACCCCAGAATCCAGAGG - Exonic
1172481001 20:35271382-35271404 ACTCGGAGCCCAGGCAGCAGAGG + Intronic
1173001550 20:39109464-39109486 AGCCAGTGCCCCGCCTGCAGTGG + Intergenic
1173599049 20:44279881-44279903 ACCCAAAAACCAGGCTGCAGTGG + Exonic
1173601260 20:44296982-44297004 ACCCTGAAACCAGACTGCAGAGG + Intergenic
1173649181 20:44651975-44651997 CAGCAGCGCCCAGACTGCAGGGG - Intronic
1173941292 20:46913523-46913545 GCCAAGAGAACAGACTGCAGGGG + Intronic
1174913674 20:54633218-54633240 ACCCAGGGCCCAGAAAGCATAGG + Intronic
1175026622 20:55909448-55909470 ACCCAGAGCCCTGATCTCAGTGG - Intergenic
1175543225 20:59761304-59761326 GCCCAGAGCCCAGGCCCCAGGGG - Intronic
1176250062 20:64116412-64116434 GCCCAGAGCCCTGACTGCCTAGG - Intergenic
1178439348 21:32585503-32585525 ATCCAGAGACCAGAGAGCAGCGG + Exonic
1178536495 21:33414309-33414331 ACGCAAAGCCCAAGCTGCAGGGG - Intronic
1179552676 21:42153509-42153531 ACTCAGCACCCAGGCTGCAGTGG + Intergenic
1180174767 21:46082222-46082244 CCCCAGAGCCCAGGGTCCAGAGG + Intergenic
1180869388 22:19137806-19137828 GCACAGAGGCCAGAGTGCAGAGG + Intronic
1181114899 22:20625884-20625906 ACCCAGAGCCCAGAGCCCAGCGG + Intergenic
1181185859 22:21103155-21103177 ACTCAGGGCCCAGACAGGAGCGG - Intergenic
1181338890 22:22163041-22163063 AACAAGAGCCCATGCTGCAGGGG - Intergenic
1181895291 22:26101805-26101827 TCCCAGAACTAAGACTGCAGTGG - Intergenic
1181942075 22:26485836-26485858 AGCCAGAGCACATACTGCTGGGG - Intronic
1182056318 22:27358121-27358143 AACCTGAGCCAAGACTTCAGGGG + Intergenic
1182656958 22:31898289-31898311 CCCCAGAGCCCAGAACCCAGAGG + Intronic
1183165910 22:36147345-36147367 CCCCTGAGACCAGCCTGCAGAGG - Intronic
1183172236 22:36197036-36197058 ACCCTGAGACCAGCCTGCAGGGG - Intronic
1183181020 22:36259707-36259729 ACCCTGAGACCAGCCTGCAGAGG + Intronic
1183702496 22:39457982-39458004 CCCCCGACCCCAGACTGCGGCGG + Intronic
1184222512 22:43110094-43110116 ACCCGGAGCCCCGACGGGAGGGG + Intergenic
1184242917 22:43220869-43220891 GCCCAGAGCCGAGTCTGCACTGG - Intronic
1184337323 22:43861714-43861736 ACCCGGAGCCCAGGCTGGAAAGG + Intronic
1184729215 22:46363874-46363896 ACCTGGAGCCCTGAGTGCAGAGG - Intronic
1184796904 22:46738102-46738124 ACCCACAGCACGGATTGCAGCGG + Exonic
1184834602 22:47013882-47013904 ACACAGACCTCTGACTGCAGAGG - Intronic
1185213314 22:49584302-49584324 AGCCAGAGCCCAAACCACAGAGG + Intronic
1185284608 22:49994662-49994684 AGCCTGGGCCCAGACTGCGGTGG + Exonic
1185343249 22:50300725-50300747 ACCCAGAGCCCAGACTGCAGGGG - Intronic
949260627 3:2099320-2099342 ACCGAGAGCCCGGAATGCTGCGG + Intronic
950156771 3:10726902-10726924 CTCCAGAGCCCAGCCTCCAGAGG - Intergenic
950502713 3:13374620-13374642 TCCCAGAGCTCAGGCTGGAGTGG + Intronic
950645289 3:14373392-14373414 ACCCAGCTCCGAGACTGCTGGGG + Intergenic
950659248 3:14456615-14456637 AACCAGAGCCCTGACTGTGGGGG + Intronic
951363885 3:21757169-21757191 ACCCAGGCCCCAGGCTGGAGTGG + Intronic
951549385 3:23861770-23861792 ACCAAGCGGCCAGACTCCAGGGG + Intronic
952410782 3:33048133-33048155 AGCCAGAGCCCAGCATGGAGGGG + Intronic
954756785 3:52844914-52844936 ACCCAGGCTCCACACTGCAGAGG + Exonic
956180700 3:66515464-66515486 ACCCAGGCTCCAGAATGCAGTGG - Intergenic
956967967 3:74485884-74485906 TCCCAGAGCCCAGGCGTCAGTGG + Intronic
957245657 3:77712611-77712633 CACCAGGGACCAGACTGCAGAGG + Intergenic
959204280 3:103284707-103284729 ACCCAAACCCCAGGCTGCAAGGG - Intergenic
959617252 3:108362136-108362158 GCCAAGAGCCCAGACTGGACAGG - Intronic
961647651 3:128400983-128401005 ACCCAAACCCCAGGATGCAGTGG - Intronic
961660124 3:128464056-128464078 AACCAGGGCCAAGGCTGCAGCGG + Exonic
961794741 3:129401512-129401534 GCCCAGAGCCCAGACACAAGAGG - Exonic
962058972 3:131904926-131904948 ACCCAGACCCCAGACTGGGCCGG - Intronic
962196003 3:133364202-133364224 ACCCTGAGGCCAGACTGCCAAGG - Intronic
962399958 3:135049859-135049881 ACTCAGAGCACAGACTTCACAGG - Intronic
963560683 3:146861312-146861334 GCCAAGAGGCCAGACTGAAGGGG - Intergenic
965519299 3:169657569-169657591 AGCCAGAACCCAGTCTCCAGAGG + Intronic
966289801 3:178342862-178342884 ACCCAGAAGCTAGACTGAAGGGG + Intergenic
968481507 4:835052-835074 ACCCACAGCCCGGCCTGCACAGG - Intergenic
968524136 4:1047327-1047349 AGGCGGAGCCCAGGCTGCAGGGG + Intergenic
968811400 4:2801118-2801140 GACCGGGGCCCAGACTGCAGGGG + Intronic
968864454 4:3198910-3198932 ACACAGAGCCTGGACCGCAGGGG + Intronic
969203592 4:5624944-5624966 ACACAGAGCCCTGAGTACAGGGG - Intronic
969262496 4:6042955-6042977 ACCCCCAGCCCAGACCCCAGAGG - Intronic
969523594 4:7692903-7692925 CTCCAGAGGTCAGACTGCAGAGG + Intronic
970293682 4:14604717-14604739 ACCCAAAACCCAGAGGGCAGAGG - Intergenic
970804767 4:20017910-20017932 ACCCAGAGCAAAAACTGAAGGGG - Intergenic
971024391 4:22574135-22574157 TCCTTGAGCCCAGACTGAAGAGG + Intergenic
971327337 4:25655308-25655330 ACCTAGAGCCCAGACTCCCAGGG + Intronic
972934422 4:44114754-44114776 ACCCAGAGACTGGAGTGCAGTGG - Intergenic
975143314 4:70939937-70939959 ACACAGTGGCCAGACTCCAGGGG - Intronic
975266394 4:72373858-72373880 ACACAGAGTCTAGAGTGCAGTGG - Intronic
975342899 4:73260892-73260914 ACACAGAGACTAGACTGCAGAGG - Intergenic
975749256 4:77506123-77506145 ACCCACAGCCCATGCTGAAGGGG - Intergenic
979233599 4:118374482-118374504 ACTCAGAGCCCACACTCCAGTGG - Intergenic
979610921 4:122688072-122688094 ACCCAGAGTCCAGAAGCCAGTGG - Intergenic
980564381 4:134519700-134519722 AAGCAAAGCTCAGACTGCAGTGG + Intergenic
981138131 4:141236397-141236419 ACCTGGAGCCCAGACTGAAGAGG + Intergenic
981724631 4:147834427-147834449 ACCCAGACTCTAGAGTGCAGTGG - Intronic
984796568 4:183665708-183665730 ACTCAGTGCCCAGACTCAAGTGG + Intronic
985331412 4:188840873-188840895 ACCCAGAGGCCAGACTGCAATGG - Intergenic
985636057 5:1036449-1036471 TCCCACAGCCCTGAGTGCAGGGG + Intronic
985806577 5:2048724-2048746 ACACAGAGCCCAGTCTGAGGTGG - Intergenic
986092073 5:4519443-4519465 ACCTGGAGCCCTGACTGGAGAGG + Intergenic
986217857 5:5737771-5737793 CTCCAGAACCCAGTCTGCAGTGG - Intergenic
986873239 5:12075571-12075593 AGCCAGAGAGCAGACTGCTGCGG + Intergenic
987156526 5:15095191-15095213 AGGCAGAGCCCAGATGGCAGTGG - Intergenic
987513549 5:18874761-18874783 ACCCAGAACCCAGGAGGCAGAGG + Intergenic
988668549 5:33356818-33356840 ACCCCCAGGCCAGAGTGCAGTGG + Intergenic
989342235 5:40389024-40389046 ACACAGAGGCCAGGCTGCTGAGG + Intergenic
990660968 5:58014640-58014662 ACACAGAGCCCAGGGTGCTGAGG - Intergenic
990881578 5:60544779-60544801 ACGCAGAGCAAAGACTCCAGTGG - Intergenic
992364093 5:76074091-76074113 AGCCAGAGCCTTCACTGCAGAGG - Intergenic
992951910 5:81867170-81867192 ACCAAGAGCCCAGATAACAGAGG - Intergenic
993740667 5:91534692-91534714 ACCCAGAGGCCTGACTACGGAGG + Intergenic
995350549 5:111170119-111170141 ACTAAGAGCCCAAACTGAAGTGG + Intergenic
995650473 5:114362655-114362677 GCCCGGAGCCCAGACTGCCGAGG - Exonic
995724856 5:115171177-115171199 TCCCACAGCCCTGTCTGCAGCGG + Intronic
995984726 5:118156094-118156116 ACCCTGAGCAGAGGCTGCAGTGG + Intergenic
996526418 5:124484974-124484996 CCCCAGAGCCTAGACTGCAGAGG + Intergenic
996804826 5:127442800-127442822 ACTCACAGTCCAGACTGCACAGG - Intronic
996815209 5:127566627-127566649 GCCCAGAGCCCAGAGCCCAGAGG + Intergenic
997336471 5:133112364-133112386 ACCAGGAGCCCAGGCTCCAGAGG + Intergenic
998805246 5:145912224-145912246 CCACAGAGCCCAGAGTCCAGTGG + Intergenic
999301233 5:150491888-150491910 ACCCGTACCCCAGACTGCATGGG + Intronic
1002027339 5:176404547-176404569 ACCCAGACTGCAGGCTGCAGCGG - Intronic
1003165164 6:3671197-3671219 ACCCAGAGCACAGTATGCTGGGG + Intergenic
1003714798 6:8634548-8634570 CCCCAGAGGCGAGATTGCAGTGG - Intergenic
1003900315 6:10648841-10648863 ACGCTAACCCCAGACTGCAGAGG - Intergenic
1004421697 6:15476262-15476284 ACCTAGAACCCAGACTGCCAGGG + Intronic
1005510099 6:26505006-26505028 ACCCAGAGCCCCAGGTGCAGTGG + Exonic
1005560106 6:27031020-27031042 TCCCAAAGCACAGACTTCAGGGG + Intergenic
1007158713 6:39771416-39771438 TTCCAGAGCCTGGACTGCAGGGG - Intergenic
1008801315 6:55371975-55371997 ACCCAGAAGCCAGACTGGAAAGG - Intronic
1009349936 6:62661557-62661579 CCCCAGACCCCAGGCTCCAGAGG - Intergenic
1009767336 6:68097460-68097482 ACCCAGGGCCTAAAGTGCAGTGG + Intergenic
1010681860 6:78807757-78807779 ACCCAGAGCCCTGGCAGCATAGG + Intergenic
1010731320 6:79394522-79394544 ACCCAGAGGACAGACTTCAGTGG + Intergenic
1014663110 6:124198377-124198399 ACCCAGAGTCCAGGCTCCATGGG - Intronic
1014871717 6:126604027-126604049 ACCCAGAGCCCAGTAGACAGAGG - Intergenic
1015226072 6:130859004-130859026 ACCCAGAGGGCTGACTCCAGTGG + Intronic
1016751668 6:147637047-147637069 ACCCAGACCTCAGCCTGCTGGGG - Intronic
1017645238 6:156534047-156534069 CTCCATAGCCCAGCCTGCAGGGG + Intergenic
1018927493 6:168216750-168216772 TCACAGAGCCCAGACTGCTCTGG + Intergenic
1020085123 7:5306232-5306254 ACCCCCAGGCCAGAGTGCAGTGG + Exonic
1021546616 7:21820651-21820673 ACCCAGAGCACAGACTTCCTTGG + Intronic
1021764022 7:23928896-23928918 CCCCCGCCCCCAGACTGCAGTGG + Intergenic
1022443527 7:30452246-30452268 GCACAGAGCACAGGCTGCAGAGG + Exonic
1022601302 7:31762734-31762756 ACACAGAGCAAAGAATGCAGGGG + Intronic
1022667508 7:32425899-32425921 ATCCAGAGCACTGTCTGCAGTGG - Intergenic
1023157377 7:37264730-37264752 ACCCAGACTCCAGACTCCAAGGG + Intronic
1023835647 7:44065793-44065815 ACCCAGAGCCCAGACTGAGTGGG + Intronic
1024265887 7:47606189-47606211 CCCCAGACCCCAGATTGCATTGG - Intergenic
1024414113 7:49082165-49082187 ACCCTGAGCCCAGAGAGCAGAGG - Intergenic
1025209166 7:57010900-57010922 ACCCCCAGGCCAGAGTGCAGTGG - Intergenic
1025238348 7:57250546-57250568 ACCCTGACCCCAGTCTGCATAGG + Intergenic
1025662780 7:63565957-63565979 ACCCCCAGGCCAGAGTGCAGTGG + Intergenic
1025782044 7:64610523-64610545 ACACACAGGCTAGACTGCAGTGG + Intergenic
1026627760 7:72011396-72011418 ACCCACAGCGCAGAGTTCAGAGG - Intronic
1026832922 7:73621387-73621409 ACCCAGAGACCAGCCTGCAGAGG - Intronic
1027359763 7:77395689-77395711 CCCCAGAGCCTAGTCTGCAAGGG - Intronic
1027648176 7:80831212-80831234 AGCCAGAATCCAGACTCCAGTGG - Intronic
1028840480 7:95424192-95424214 TCACAGAACACAGACTGCAGCGG + Intronic
1029401951 7:100352395-100352417 CCCCAGAACCCGGACTGGAGGGG + Exonic
1031900746 7:127408113-127408135 ACCCAGAGGCTAGAGTGCAGTGG + Intronic
1032240906 7:130158095-130158117 ATCCAGGGCCTGGACTGCAGAGG - Intergenic
1033292291 7:140096647-140096669 ATACAAAGCACAGACTGCAGTGG - Exonic
1033596710 7:142864327-142864349 TCCCACAGCCCACGCTGCAGAGG - Exonic
1034894384 7:154866485-154866507 ACCCAGAGACTTGGCTGCAGAGG - Intronic
1034936159 7:155202388-155202410 GCCTAGAGCACAGACTGCAGGGG - Intergenic
1034943631 7:155248205-155248227 ACACAGAGCCCAGGCAGCACCGG - Intergenic
1035128788 7:156631511-156631533 ATCCAGACCCCAGAATCCAGAGG - Intergenic
1035354614 7:158269484-158269506 CCCCAGAGCCCAGACTTCCCAGG - Intronic
1035374142 7:158396085-158396107 ACCAAGCTCCCAGGCTGCAGAGG + Intronic
1036045510 8:5135610-5135632 ACTCTGTGCCCAGGCTGCAGTGG + Intergenic
1037393240 8:18416435-18416457 ACCATGAGCCCAGAGGGCAGAGG - Intergenic
1038732321 8:30138660-30138682 AGCCACAGCGCAGACAGCAGGGG + Exonic
1040384647 8:46906133-46906155 ACCCAGATCCCAGGCTGGAGGGG - Intergenic
1041997007 8:64074960-64074982 TCCCAGAGCCCAGACTTGAATGG - Intergenic
1042269480 8:66940987-66941009 ACCCAGAGGACAGACAGCATGGG - Intergenic
1042330945 8:67580072-67580094 ACCCAGAGCACTAACAGCAGAGG + Intronic
1043395869 8:79835328-79835350 ACTCAGAGCCAAGGCTGGAGCGG + Intergenic
1044347418 8:91121192-91121214 ACACAGAGGCAATACTGCAGTGG - Intronic
1045730387 8:105232106-105232128 AAGCAGAAACCAGACTGCAGTGG + Intronic
1047329746 8:123876097-123876119 AGACAAAGGCCAGACTGCAGAGG - Intronic
1047533602 8:125699082-125699104 AGCCAGAGCACAGAGCGCAGAGG - Intergenic
1048080640 8:131122669-131122691 AGCCAGAAACCAGACCGCAGGGG - Intergenic
1048469531 8:134695129-134695151 AACCATGGCCCAGGCTGCAGTGG + Intronic
1049205146 8:141360169-141360191 CCCCAGAGGCCAGACCGGAGAGG + Intronic
1049575830 8:143389185-143389207 GGCCAGAGCCCTGACTCCAGAGG - Intergenic
1049617095 8:143580406-143580428 CCCCAGAACCCAGAGGGCAGGGG + Intronic
1049660781 8:143818843-143818865 ACCCAGCCCCCAGACTGGAGGGG - Intronic
1049748021 8:144271154-144271176 GCCCCCAGCCCAGACTGCACCGG + Intronic
1049748613 8:144273377-144273399 CCCCAGACTCCAGACTCCAGTGG + Intronic
1050043614 9:1521075-1521097 ACCAAGAGACCCGACTCCAGGGG + Intergenic
1050118225 9:2282126-2282148 ACCCAGAGCCCAAGGTGCAGAGG - Intergenic
1050128434 9:2383837-2383859 ACTGAGAGCCCAGACTGAAATGG + Intergenic
1050261180 9:3842430-3842452 ACCCCCAGGCTAGACTGCAGTGG - Intronic
1050707871 9:8424325-8424347 ACCCAGACCTCAGACTACACGGG + Intronic
1051671600 9:19516091-19516113 GCCCAGAGCCCAGAGTGTGGAGG + Exonic
1052030488 9:23622599-23622621 ACCCAGTGCCCAGAATGCTTAGG + Intergenic
1056499049 9:87189991-87190013 TCCCCCAGGCCAGACTGCAGTGG - Intergenic
1057522095 9:95768278-95768300 ACCCAGAGGCTGGAGTGCAGTGG - Intergenic
1057548191 9:96033637-96033659 ACCCAGATCCCAGCCTCCTGGGG - Intergenic
1057699427 9:97352368-97352390 ACCCAGAGCCCAGACAGAATTGG - Intronic
1059659415 9:116386733-116386755 ACCATGAGCCCAGACTGCCAGGG + Intronic
1059748850 9:117229164-117229186 ACCCAGGGCCCAGGCTGCAGGGG + Intronic
1060721891 9:125984956-125984978 ATTCTAAGCCCAGACTGCAGGGG - Intergenic
1060773141 9:126347198-126347220 ACCCAGAGCCCAGTCTGAGAGGG + Intronic
1060893269 9:127201935-127201957 AGCCAGAGCCAAGGGTGCAGGGG + Intronic
1061479940 9:130892664-130892686 ACCCAGAACTCAGACTGTGGGGG + Intergenic
1061871579 9:133523569-133523591 ACCCAGAGGCAAGAAGGCAGGGG + Intronic
1062065064 9:134522249-134522271 ACCCAGGGCCCAGACAGAGGTGG - Intergenic
1062393589 9:136343608-136343630 GCCCACAGCCTAAACTGCAGGGG - Intronic
1062475327 9:136723890-136723912 ATCCAGAGCCCTGACGGTAGGGG - Exonic
1062482019 9:136756945-136756967 GCCCAGACCCCACGCTGCAGCGG + Intronic
1062499960 9:136848071-136848093 CTGCAGGGCCCAGACTGCAGCGG - Exonic
1062694559 9:137866768-137866790 ACCCTCAGCACAGGCTGCAGAGG + Intronic
1186436470 X:9547210-9547232 ACACAGTGCCCAGCCTGGAGGGG - Intronic
1187834540 X:23418037-23418059 GCCCAGATCACAGACTGTAGGGG + Intergenic
1189409625 X:40758599-40758621 ACCCAAACCCCAGCCTGCAGTGG + Intergenic
1189601371 X:42630248-42630270 AACCAGGGCCCAAACTGGAGGGG - Intergenic
1190779863 X:53583634-53583656 ACCCAGAGCTCAGGCTTCAATGG - Exonic
1191105946 X:56772501-56772523 ACACAGAGCCAAGACTCCAGGGG - Intergenic
1191106939 X:56777903-56777925 ACACAGAGCCAAGACTCCAGGGG - Intergenic
1196124436 X:112083319-112083341 GCCCAGAGCCCAGGCTGACGGGG - Intergenic
1197755869 X:129994242-129994264 ACCCATAGCCTACACTGCGGTGG - Intronic
1199899211 X:152156771-152156793 ACCCAGAATCCAGAGTTCAGGGG + Intergenic
1200863750 Y:8020529-8020551 ACCCAGTGCCCTGCCTACAGGGG - Intergenic