ID: 1185344672

View in Genome Browser
Species Human (GRCh38)
Location 22:50306072-50306094
Sequence CGTGTCCAGTCACCCGAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 40}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185344672_1185344682 23 Left 1185344672 22:50306072-50306094 CCCGCTTCGGGTGACTGGACACG 0: 1
1: 0
2: 0
3: 0
4: 40
Right 1185344682 22:50306118-50306140 TTCTTGGCAGGCAGCCGGTGGGG 0: 1
1: 0
2: 1
3: 13
4: 154
1185344672_1185344678 11 Left 1185344672 22:50306072-50306094 CCCGCTTCGGGTGACTGGACACG 0: 1
1: 0
2: 0
3: 0
4: 40
Right 1185344678 22:50306106-50306128 CAAAATAATTCTTTCTTGGCAGG 0: 1
1: 0
2: 10
3: 55
4: 582
1185344672_1185344684 27 Left 1185344672 22:50306072-50306094 CCCGCTTCGGGTGACTGGACACG 0: 1
1: 0
2: 0
3: 0
4: 40
Right 1185344684 22:50306122-50306144 TGGCAGGCAGCCGGTGGGGGAGG 0: 1
1: 0
2: 7
3: 55
4: 585
1185344672_1185344685 28 Left 1185344672 22:50306072-50306094 CCCGCTTCGGGTGACTGGACACG 0: 1
1: 0
2: 0
3: 0
4: 40
Right 1185344685 22:50306123-50306145 GGCAGGCAGCCGGTGGGGGAGGG 0: 1
1: 0
2: 7
3: 61
4: 677
1185344672_1185344676 7 Left 1185344672 22:50306072-50306094 CCCGCTTCGGGTGACTGGACACG 0: 1
1: 0
2: 0
3: 0
4: 40
Right 1185344676 22:50306102-50306124 GATCCAAAATAATTCTTTCTTGG 0: 1
1: 0
2: 3
3: 23
4: 282
1185344672_1185344679 18 Left 1185344672 22:50306072-50306094 CCCGCTTCGGGTGACTGGACACG 0: 1
1: 0
2: 0
3: 0
4: 40
Right 1185344679 22:50306113-50306135 ATTCTTTCTTGGCAGGCAGCCGG 0: 1
1: 0
2: 3
3: 21
4: 234
1185344672_1185344687 30 Left 1185344672 22:50306072-50306094 CCCGCTTCGGGTGACTGGACACG 0: 1
1: 0
2: 0
3: 0
4: 40
Right 1185344687 22:50306125-50306147 CAGGCAGCCGGTGGGGGAGGGGG 0: 1
1: 1
2: 10
3: 95
4: 872
1185344672_1185344681 22 Left 1185344672 22:50306072-50306094 CCCGCTTCGGGTGACTGGACACG 0: 1
1: 0
2: 0
3: 0
4: 40
Right 1185344681 22:50306117-50306139 TTTCTTGGCAGGCAGCCGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 160
1185344672_1185344683 24 Left 1185344672 22:50306072-50306094 CCCGCTTCGGGTGACTGGACACG 0: 1
1: 0
2: 0
3: 0
4: 40
Right 1185344683 22:50306119-50306141 TCTTGGCAGGCAGCCGGTGGGGG 0: 1
1: 0
2: 2
3: 17
4: 203
1185344672_1185344686 29 Left 1185344672 22:50306072-50306094 CCCGCTTCGGGTGACTGGACACG 0: 1
1: 0
2: 0
3: 0
4: 40
Right 1185344686 22:50306124-50306146 GCAGGCAGCCGGTGGGGGAGGGG 0: 1
1: 0
2: 4
3: 62
4: 764
1185344672_1185344680 21 Left 1185344672 22:50306072-50306094 CCCGCTTCGGGTGACTGGACACG 0: 1
1: 0
2: 0
3: 0
4: 40
Right 1185344680 22:50306116-50306138 CTTTCTTGGCAGGCAGCCGGTGG 0: 1
1: 0
2: 0
3: 17
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185344672 Original CRISPR CGTGTCCAGTCACCCGAAGC GGG (reversed) Intronic
904541678 1:31238112-31238134 CTTGTCCAGTCTCCCACAGCTGG + Intronic
912209143 1:107539532-107539554 TGTGTTCAGTCACCCGAGACTGG + Intergenic
916390030 1:164321380-164321402 CGCTTCCAGCCACCCGCAGCCGG + Intergenic
918204557 1:182297428-182297450 TGTGTCCAGTCTCCAGAGGCAGG - Intergenic
921627614 1:217395190-217395212 CTAGTCCAGTCAGCTGAAGCTGG - Intergenic
1073136298 10:101222452-101222474 CTTTTCCAGTCACCTGAACCCGG - Intergenic
1077208773 11:1358385-1358407 CCTGGCCAGTGACCAGAAGCAGG - Intergenic
1077431705 11:2518904-2518926 GGCGTCCATTCACCCGGAGCTGG + Intronic
1078291542 11:10015434-10015456 CGTGAGAAGTCACCAGAAGCTGG - Intronic
1084307564 11:68297000-68297022 CGAATGCAGTCACCGGAAGCAGG + Intergenic
1109062484 13:57634781-57634803 CGAGTACAGCCACCCGCAGCTGG + Exonic
1124256970 15:28152188-28152210 CGTGTCCAGTCAGCAGATCCAGG + Intronic
1124567361 15:30828342-30828364 CGTGTCCAGTCAGCAGATCCAGG - Intergenic
1132859503 16:2063057-2063079 CGTGTCCAGGCGGCCGCAGCTGG + Intronic
1145271278 17:21406144-21406166 CCTGCCCAGTCACCTGGAGCTGG - Intronic
1150212802 17:63450671-63450693 CCTGTCCCCTCCCCCGAAGCTGG - Intergenic
1152120384 17:78414765-78414787 CGTGTCCAGGCACCCAGGGCAGG + Intronic
1155840828 18:30640599-30640621 TGTGTCCTGTCACCCCAAGAAGG + Intergenic
1160433900 18:78831679-78831701 TGTGTGCAGGCACCAGAAGCTGG - Intergenic
1166523150 19:43494955-43494977 CGTGTCCAGTCTCCCAATGTAGG + Intronic
1170684398 20:18555972-18555994 CGTCTCCCGTCACCCCCAGCTGG - Intronic
1179803052 21:43820648-43820670 CGCCTAGAGTCACCCGAAGCGGG + Intergenic
1180142117 21:45899001-45899023 TGTGGCCTGTCACCTGAAGCGGG - Intronic
1185344672 22:50306072-50306094 CGTGTCCAGTCACCCGAAGCGGG - Intronic
952879077 3:37971731-37971753 TGTGTGCAGCCACCTGAAGCTGG + Intronic
954487918 3:50872405-50872427 TGTTTCGAGTCACCTGAAGCTGG + Intronic
959067777 3:101676175-101676197 GGGGACGAGTCACCCGAAGCCGG - Intronic
961593134 3:127995817-127995839 CCTGTCCAGTCCCCCAATGCTGG - Intergenic
986256426 5:6104635-6104657 CGTCTGCAGCCACCAGAAGCTGG + Intergenic
990399826 5:55427299-55427321 GGTGTTCAGTCACCAAAAGCTGG + Intronic
996311458 5:122111107-122111129 CAGGTCCAGTCACCGTAAGCTGG - Intergenic
998912669 5:146977256-146977278 CTTGTTCTGTCACCCCAAGCTGG + Intronic
1008208629 6:48694022-48694044 AGTGTCCAGGCACCCCAGGCAGG - Intergenic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1026971759 7:74472861-74472883 CCTGTCCAGCCTCCCGAACCAGG - Intronic
1034880024 7:154756345-154756367 CGTCTCCAGGCCCCCGAGGCTGG + Intronic
1040420836 8:47239154-47239176 CACGGCCACTCACCCGAAGCTGG - Intergenic
1048483741 8:134828315-134828337 CGTGCCCAGTATCCCGAAGTTGG + Intergenic
1060524692 9:124313860-124313882 TGTGTCCAGTGACCCAAAGGAGG - Intronic
1201641407 Y:16181099-16181121 CGTGTCCAGTCTCCATCAGCTGG - Intergenic
1201661408 Y:16404223-16404245 CGTGTCCAGTCTCCATCAGCTGG + Intergenic