ID: 1185344697

View in Genome Browser
Species Human (GRCh38)
Location 22:50306185-50306207
Sequence GTTCCTTGCCCCAGTAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185344697_1185344712 23 Left 1185344697 22:50306185-50306207 CCTCCTCTACTGGGGCAAGGAAC No data
Right 1185344712 22:50306231-50306253 CAGACCCCCCGGGACAGAGGTGG No data
1185344697_1185344700 -5 Left 1185344697 22:50306185-50306207 CCTCCTCTACTGGGGCAAGGAAC No data
Right 1185344700 22:50306203-50306225 GGAACCCCTGGCCAGACCTCAGG No data
1185344697_1185344713 24 Left 1185344697 22:50306185-50306207 CCTCCTCTACTGGGGCAAGGAAC No data
Right 1185344713 22:50306232-50306254 AGACCCCCCGGGACAGAGGTGGG No data
1185344697_1185344707 13 Left 1185344697 22:50306185-50306207 CCTCCTCTACTGGGGCAAGGAAC No data
Right 1185344707 22:50306221-50306243 TCAGGCCTCCCAGACCCCCCGGG No data
1185344697_1185344709 20 Left 1185344697 22:50306185-50306207 CCTCCTCTACTGGGGCAAGGAAC No data
Right 1185344709 22:50306228-50306250 TCCCAGACCCCCCGGGACAGAGG No data
1185344697_1185344706 12 Left 1185344697 22:50306185-50306207 CCTCCTCTACTGGGGCAAGGAAC No data
Right 1185344706 22:50306220-50306242 CTCAGGCCTCCCAGACCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185344697 Original CRISPR GTTCCTTGCCCCAGTAGAGG AGG (reversed) Intronic