ID: 1185344702

View in Genome Browser
Species Human (GRCh38)
Location 22:50306208-50306230
Sequence GGAGGCCTGAGGTCTGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185344702_1185344709 -3 Left 1185344702 22:50306208-50306230 CCCTGGCCAGACCTCAGGCCTCC No data
Right 1185344709 22:50306228-50306250 TCCCAGACCCCCCGGGACAGAGG No data
1185344702_1185344723 24 Left 1185344702 22:50306208-50306230 CCCTGGCCAGACCTCAGGCCTCC No data
Right 1185344723 22:50306255-50306277 CCCCCCATAGGTACCGTGGGAGG No data
1185344702_1185344712 0 Left 1185344702 22:50306208-50306230 CCCTGGCCAGACCTCAGGCCTCC No data
Right 1185344712 22:50306231-50306253 CAGACCCCCCGGGACAGAGGTGG No data
1185344702_1185344721 21 Left 1185344702 22:50306208-50306230 CCCTGGCCAGACCTCAGGCCTCC No data
Right 1185344721 22:50306252-50306274 GGGCCCCCCATAGGTACCGTGGG No data
1185344702_1185344720 20 Left 1185344702 22:50306208-50306230 CCCTGGCCAGACCTCAGGCCTCC No data
Right 1185344720 22:50306251-50306273 TGGGCCCCCCATAGGTACCGTGG No data
1185344702_1185344707 -10 Left 1185344702 22:50306208-50306230 CCCTGGCCAGACCTCAGGCCTCC No data
Right 1185344707 22:50306221-50306243 TCAGGCCTCCCAGACCCCCCGGG No data
1185344702_1185344713 1 Left 1185344702 22:50306208-50306230 CCCTGGCCAGACCTCAGGCCTCC No data
Right 1185344713 22:50306232-50306254 AGACCCCCCGGGACAGAGGTGGG No data
1185344702_1185344719 12 Left 1185344702 22:50306208-50306230 CCCTGGCCAGACCTCAGGCCTCC No data
Right 1185344719 22:50306243-50306265 GACAGAGGTGGGCCCCCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185344702 Original CRISPR GGAGGCCTGAGGTCTGGCCA GGG (reversed) Intronic