ID: 1185344703

View in Genome Browser
Species Human (GRCh38)
Location 22:50306209-50306231
Sequence GGGAGGCCTGAGGTCTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185344703_1185344721 20 Left 1185344703 22:50306209-50306231 CCTGGCCAGACCTCAGGCCTCCC No data
Right 1185344721 22:50306252-50306274 GGGCCCCCCATAGGTACCGTGGG No data
1185344703_1185344709 -4 Left 1185344703 22:50306209-50306231 CCTGGCCAGACCTCAGGCCTCCC No data
Right 1185344709 22:50306228-50306250 TCCCAGACCCCCCGGGACAGAGG No data
1185344703_1185344723 23 Left 1185344703 22:50306209-50306231 CCTGGCCAGACCTCAGGCCTCCC No data
Right 1185344723 22:50306255-50306277 CCCCCCATAGGTACCGTGGGAGG No data
1185344703_1185344720 19 Left 1185344703 22:50306209-50306231 CCTGGCCAGACCTCAGGCCTCCC No data
Right 1185344720 22:50306251-50306273 TGGGCCCCCCATAGGTACCGTGG No data
1185344703_1185344712 -1 Left 1185344703 22:50306209-50306231 CCTGGCCAGACCTCAGGCCTCCC No data
Right 1185344712 22:50306231-50306253 CAGACCCCCCGGGACAGAGGTGG No data
1185344703_1185344713 0 Left 1185344703 22:50306209-50306231 CCTGGCCAGACCTCAGGCCTCCC No data
Right 1185344713 22:50306232-50306254 AGACCCCCCGGGACAGAGGTGGG No data
1185344703_1185344719 11 Left 1185344703 22:50306209-50306231 CCTGGCCAGACCTCAGGCCTCCC No data
Right 1185344719 22:50306243-50306265 GACAGAGGTGGGCCCCCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185344703 Original CRISPR GGGAGGCCTGAGGTCTGGCC AGG (reversed) Intronic