ID: 1185344704

View in Genome Browser
Species Human (GRCh38)
Location 22:50306214-50306236
Sequence GGTCTGGGAGGCCTGAGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185344704_1185344709 -9 Left 1185344704 22:50306214-50306236 CCAGACCTCAGGCCTCCCAGACC No data
Right 1185344709 22:50306228-50306250 TCCCAGACCCCCCGGGACAGAGG No data
1185344704_1185344712 -6 Left 1185344704 22:50306214-50306236 CCAGACCTCAGGCCTCCCAGACC No data
Right 1185344712 22:50306231-50306253 CAGACCCCCCGGGACAGAGGTGG No data
1185344704_1185344723 18 Left 1185344704 22:50306214-50306236 CCAGACCTCAGGCCTCCCAGACC No data
Right 1185344723 22:50306255-50306277 CCCCCCATAGGTACCGTGGGAGG No data
1185344704_1185344719 6 Left 1185344704 22:50306214-50306236 CCAGACCTCAGGCCTCCCAGACC No data
Right 1185344719 22:50306243-50306265 GACAGAGGTGGGCCCCCCATAGG No data
1185344704_1185344721 15 Left 1185344704 22:50306214-50306236 CCAGACCTCAGGCCTCCCAGACC No data
Right 1185344721 22:50306252-50306274 GGGCCCCCCATAGGTACCGTGGG No data
1185344704_1185344713 -5 Left 1185344704 22:50306214-50306236 CCAGACCTCAGGCCTCCCAGACC No data
Right 1185344713 22:50306232-50306254 AGACCCCCCGGGACAGAGGTGGG No data
1185344704_1185344720 14 Left 1185344704 22:50306214-50306236 CCAGACCTCAGGCCTCCCAGACC No data
Right 1185344720 22:50306251-50306273 TGGGCCCCCCATAGGTACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185344704 Original CRISPR GGTCTGGGAGGCCTGAGGTC TGG (reversed) Intronic