ID: 1185344712

View in Genome Browser
Species Human (GRCh38)
Location 22:50306231-50306253
Sequence CAGACCCCCCGGGACAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 210}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185344702_1185344712 0 Left 1185344702 22:50306208-50306230 CCCTGGCCAGACCTCAGGCCTCC 0: 1
1: 0
2: 5
3: 69
4: 447
Right 1185344712 22:50306231-50306253 CAGACCCCCCGGGACAGAGGTGG 0: 1
1: 0
2: 1
3: 18
4: 210
1185344704_1185344712 -6 Left 1185344704 22:50306214-50306236 CCAGACCTCAGGCCTCCCAGACC 0: 1
1: 0
2: 7
3: 95
4: 902
Right 1185344712 22:50306231-50306253 CAGACCCCCCGGGACAGAGGTGG 0: 1
1: 0
2: 1
3: 18
4: 210
1185344697_1185344712 23 Left 1185344697 22:50306185-50306207 CCTCCTCTACTGGGGCAAGGAAC 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1185344712 22:50306231-50306253 CAGACCCCCCGGGACAGAGGTGG 0: 1
1: 0
2: 1
3: 18
4: 210
1185344701_1185344712 1 Left 1185344701 22:50306207-50306229 CCCCTGGCCAGACCTCAGGCCTC No data
Right 1185344712 22:50306231-50306253 CAGACCCCCCGGGACAGAGGTGG 0: 1
1: 0
2: 1
3: 18
4: 210
1185344698_1185344712 20 Left 1185344698 22:50306188-50306210 CCTCTACTGGGGCAAGGAACCCC No data
Right 1185344712 22:50306231-50306253 CAGACCCCCCGGGACAGAGGTGG 0: 1
1: 0
2: 1
3: 18
4: 210
1185344696_1185344712 24 Left 1185344696 22:50306184-50306206 CCCTCCTCTACTGGGGCAAGGAA 0: 1
1: 0
2: 2
3: 18
4: 142
Right 1185344712 22:50306231-50306253 CAGACCCCCCGGGACAGAGGTGG 0: 1
1: 0
2: 1
3: 18
4: 210
1185344703_1185344712 -1 Left 1185344703 22:50306209-50306231 CCTGGCCAGACCTCAGGCCTCCC No data
Right 1185344712 22:50306231-50306253 CAGACCCCCCGGGACAGAGGTGG 0: 1
1: 0
2: 1
3: 18
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185344712 Original CRISPR CAGACCCCCCGGGACAGAGG TGG Intronic
900190970 1:1352048-1352070 CAGTCCTCCCAGGACAGTGGGGG - Intergenic
900667217 1:3823643-3823665 CAGACCTCCCTGGGCAGGGGAGG - Intronic
900724019 1:4203085-4203107 CAGGCCTCCTGGGACAGAAGAGG + Intergenic
900861786 1:5238852-5238874 CAGTTCCCCGGGGACAGATGTGG + Intergenic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
901362086 1:8710249-8710271 CAGTCCCCCCAGGACTTAGGGGG - Intronic
904538633 1:31217805-31217827 CAGAACCCCAGGGACACAGTGGG - Intronic
904590872 1:31614748-31614770 CAGCCCTCCCTGGGCAGAGGAGG + Intergenic
905336282 1:37246831-37246853 CAGACCTCCCGGAGCAGGGGCGG + Intergenic
906743711 1:48207183-48207205 CAGGCCCCCAGGGTCAGATGTGG - Intergenic
907311436 1:53541199-53541221 CAGACGCTCAGGGACAGAGCCGG + Intronic
909579556 1:77219087-77219109 CAAACCCTCGGAGACAGAGGAGG - Intronic
912978348 1:114349348-114349370 CAGGCCCCCAGGGACAAATGTGG + Intergenic
919835234 1:201568816-201568838 CAGACACCCTGGGAAAGAAGAGG - Intergenic
920087238 1:203426580-203426602 CAGAAGCCCCGTGACAGATGTGG - Intergenic
922425088 1:225484968-225484990 CAGGCCTCCTGGGACAGATGGGG - Intergenic
1062801538 10:384877-384899 CAGGCCCCCAGGGAAGGAGGAGG + Intronic
1063580496 10:7301940-7301962 CTGACCCCAAGGGACAGGGGAGG + Intronic
1067119922 10:43465057-43465079 CAGCCGCCCCGGGAGGGAGGTGG - Intronic
1067147208 10:43702453-43702475 CAGCCTCCCCTGTACAGAGGCGG + Intergenic
1069638197 10:69938250-69938272 CAGAAGCCCCAGGTCAGAGGTGG + Intronic
1070306068 10:75239915-75239937 GAGATCCCCCGGGACTGAGCAGG + Intergenic
1070957841 10:80475910-80475932 CAAACCCCCTTGGACAGTGGAGG - Intronic
1073100235 10:101002643-101002665 CTGGCCCCCCGGGACAGGGCCGG - Exonic
1076533241 10:131159373-131159395 CAGAGCCCCCAGGACTAAGGAGG - Intronic
1076734771 10:132453673-132453695 CAGGACCCCAGGCACAGAGGTGG + Intergenic
1076884525 10:133255645-133255667 AAGACCTCCAGGGACAGATGGGG + Intergenic
1077046835 11:550407-550429 CAGACTTCCAGTGACAGAGGAGG - Intronic
1077093971 11:791618-791640 AACACCCCCAGGGACAGAGCTGG - Exonic
1077556895 11:3230292-3230314 CAGCCCTCCCAGGACACAGGAGG - Intronic
1077916024 11:6612039-6612061 CAGCCCCGCGGGGACAGCGGGGG - Exonic
1080941279 11:36921429-36921451 GAGACACCCCCGGAGAGAGGGGG - Intergenic
1081812138 11:45920143-45920165 CAGACTCCCCAGGACAGAATAGG + Intergenic
1083457164 11:62786925-62786947 GAGAGCCCCCGGGGCAGCGGCGG + Exonic
1084189644 11:67493187-67493209 CAGTCCCACGGGGACAGGGGCGG + Intronic
1084492529 11:69486591-69486613 AAGACCCCCCAGGACAGCGAGGG - Intergenic
1084659444 11:70538337-70538359 CAAGCCCCTCGGGACAAAGGCGG - Intronic
1085173297 11:74466708-74466730 CATACCCCATGGGACAGAAGGGG - Intronic
1085311633 11:75520421-75520443 CACACCCTCCGGGCCAGGGGAGG - Intronic
1088764164 11:112960807-112960829 CAGATCCCCTGGGAAGGAGGTGG - Intergenic
1089344826 11:117784512-117784534 CAGAACTCCAGGGACAGAAGGGG + Intronic
1090228667 11:125086491-125086513 CATGCCCTCGGGGACAGAGGAGG + Intronic
1091754483 12:3042612-3042634 CAATCCCCCAGGGACAGGGGAGG - Intergenic
1091823643 12:3493538-3493560 CAGACCCCGCGCGGCAGCGGGGG - Intronic
1092779264 12:11970252-11970274 TAGACCCCCCTGGACAGATGCGG - Intergenic
1092913513 12:13169028-13169050 CAGATCCCCTGGGACAGGGTGGG - Intergenic
1096262909 12:50104126-50104148 TAGGCCCCCCAAGACAGAGGTGG + Intronic
1096983429 12:55742335-55742357 GAGAGCCCAGGGGACAGAGGTGG - Intergenic
1103923451 12:124411341-124411363 CAGACCCAGAGGGACAGAGATGG + Intronic
1104753203 12:131252841-131252863 CAGCCCCCCAGAGACACAGGGGG - Intergenic
1105696864 13:22897699-22897721 CTGACCCCCCGAGAAAGAGCAGG - Intergenic
1107830795 13:44373005-44373027 CAGACCCCTCGGGACAAGGGTGG + Intergenic
1107834841 13:44404843-44404865 CAGCACCCCCTGGACAGAGATGG - Intergenic
1113494126 13:110714317-110714339 CGGACCCGCCGGGAAGGAGGCGG - Intronic
1114613297 14:24055685-24055707 CAGAGCCCTGAGGACAGAGGGGG - Exonic
1117292206 14:54344773-54344795 CAGACGGCCTGGGACAGAGTGGG - Intergenic
1119812135 14:77531030-77531052 CAGAATCCCAGGGAAAGAGGTGG + Intronic
1121032904 14:90674625-90674647 CAGAGCCCCTGGCACAGAAGAGG + Intronic
1121324873 14:93013989-93014011 CAGAGGCCCCAGGAGAGAGGAGG - Intronic
1122703458 14:103605702-103605724 CAGACCACCAGGGACAGGGGAGG - Intronic
1122794552 14:104199548-104199570 CAGAACCCTCAGGAAAGAGGTGG + Intergenic
1122891868 14:104735755-104735777 CGGAACCCTGGGGACAGAGGTGG - Intronic
1122955745 14:105070111-105070133 CAGCCTCCCCGAGACAGAAGAGG + Intergenic
1123060482 14:105592150-105592172 CAGAGACCCCGAGACAGAGATGG + Intergenic
1123084960 14:105713121-105713143 CAGAGACCCCGAGACAGAGATGG + Intergenic
1124369936 15:29098850-29098872 CTGACCTCTGGGGACAGAGGAGG + Intronic
1127456370 15:59159372-59159394 CAGACCCCAGGGCACAGAGCCGG - Intronic
1128079066 15:64845471-64845493 CAGGCCCCCCTGGAGGGAGGGGG + Intronic
1128667988 15:69552692-69552714 CAGATGCCCCAGGAGAGAGGAGG + Intergenic
1128879546 15:71230688-71230710 GAGACCAACAGGGACAGAGGTGG - Intronic
1129333178 15:74838170-74838192 CGGAGCCCCCGGGCCGGAGGCGG - Exonic
1130115219 15:81000673-81000695 CAGAGCCCCCGGGCCGGAGCAGG + Intergenic
1130402990 15:83574403-83574425 CAGACCCTGCGGCCCAGAGGAGG - Intronic
1132685743 16:1161390-1161412 CAGAGCCCCCTGGCCGGAGGTGG + Intronic
1133035451 16:3031508-3031530 CAGAGCCCCTGGGACACAGCAGG - Intronic
1136161999 16:28426217-28426239 CAGACCTCACTGGAGAGAGGTGG + Intergenic
1136200967 16:28688773-28688795 CAGACCTCACTGGAGAGAGGTGG - Intronic
1136217307 16:28802957-28802979 CAGACCTCACTGGAGAGAGGTGG - Intergenic
1137944046 16:52716984-52717006 CACAACCCCCGTGTCAGAGGTGG + Intergenic
1141152214 16:81572104-81572126 AAGAGCCCCCGGGAGACAGGAGG - Intronic
1141624690 16:85255006-85255028 GAGACCGCCCGCGGCAGAGGTGG - Intergenic
1142014898 16:87740233-87740255 CAGGCCCACCGTGACTGAGGAGG + Intronic
1142673433 17:1498242-1498264 CAGACCCCCGGGGCCAGAGCCGG + Intronic
1143411907 17:6714027-6714049 GACAGCCCCTGGGACAGAGGAGG - Intergenic
1144212131 17:13024571-13024593 CAGTTCTCCCGGGTCAGAGGAGG + Intergenic
1144777824 17:17793616-17793638 CCCACCACCCTGGACAGAGGAGG - Exonic
1146312003 17:31776485-31776507 CAGAGCTCCTGGGCCAGAGGAGG - Intergenic
1147378105 17:40035008-40035030 CAGATCCTCCTGGAAAGAGGTGG + Intronic
1149865318 17:60148322-60148344 CAGGCCCCCCAGGAGAGAGGGGG - Intergenic
1152464697 17:80459169-80459191 CAGACATCCTGGGAGAGAGGAGG - Intergenic
1152544258 17:80992658-80992680 CTGACCCCCCGGGGCACAGCCGG + Intronic
1152570909 17:81120860-81120882 CCGAGCCCCCGGGCCAGAGCTGG - Exonic
1152579101 17:81158212-81158234 CAGACCCCGCGGCAGAGAGCAGG + Intronic
1154360117 18:13653906-13653928 CAGCCTCCCAGGGACAGTGGGGG - Intergenic
1160510184 18:79449041-79449063 CAGACCCCCCGGGACTGGGAGGG - Intronic
1160793382 19:933142-933164 CAGATGCCAGGGGACAGAGGAGG - Intronic
1160867173 19:1261109-1261131 CAGACGCGCGGGGAGAGAGGCGG - Intronic
1161043283 19:2121395-2121417 CAGAATCCACGGGACACAGGCGG + Intronic
1163696178 19:18764641-18764663 CAGACCCCAGGGCAGAGAGGGGG + Intronic
1165685678 19:37817668-37817690 CAGCACCCCCGGGCCTGAGGAGG - Intergenic
1166547179 19:43640386-43640408 CTGAGCCACCGGGACAGGGGAGG + Intergenic
1167265175 19:48479493-48479515 CAGACCCACCGGGACAGCCCAGG - Intronic
1167413201 19:49356930-49356952 CAGAGACCCAGAGACAGAGGGGG - Intronic
1167464260 19:49641982-49642004 CTGTCCCCGCGCGACAGAGGCGG + Intergenic
1167475930 19:49700997-49701019 CAGAGACCCAGGGACAGAGGAGG - Intronic
1167485072 19:49758042-49758064 CAGAGACCCAGAGACAGAGGGGG - Intronic
1167740663 19:51323220-51323242 CAGAGACCCAGAGACAGAGGGGG - Intronic
1168286805 19:55339328-55339350 CAGACCCGGCGGGAGGGAGGCGG - Intergenic
925751072 2:7090944-7090966 CAGACCCTCAGAGACAGAGAGGG - Intergenic
926775561 2:16419145-16419167 CAGCCACCCTGGGACAGAGGTGG + Intergenic
930004845 2:46888557-46888579 CAGACCCCGAGGGAGAGAGAGGG - Intergenic
932460106 2:71876449-71876471 CAGGCCCCCAGGGGGAGAGGTGG - Intergenic
933940784 2:87243461-87243483 CAGAGCCCCCCAGACAAAGGTGG - Intergenic
936352355 2:111722551-111722573 CAGAGCCCCCCAGACAAAGGTGG + Intergenic
937043111 2:118836078-118836100 CAGCCCCCACTGGAGAGAGGGGG + Intergenic
937231977 2:120403454-120403476 CAGAACCCCCGGGGCAGGGCAGG - Intergenic
937310129 2:120897011-120897033 CAGGCCACCTGGGACAGAGGTGG - Intronic
937349282 2:121150195-121150217 CAGTCCCCCCGGGTGACAGGGGG - Intergenic
938013150 2:127845060-127845082 CAGAACCCCTGGCACATAGGTGG + Intergenic
938073567 2:128320428-128320450 CAGTCCCCATGGGACACAGGTGG + Intergenic
941971850 2:171359064-171359086 CAGACCACCCTGGGCTGAGGTGG + Intronic
942954206 2:181755152-181755174 CAAACACCCCAGGCCAGAGGAGG - Intergenic
946519727 2:220451594-220451616 CAAACGCTCAGGGACAGAGGAGG - Intergenic
948165811 2:235861711-235861733 CAGTCCCCCAGGGACACAGTGGG - Intronic
948375969 2:237520337-237520359 CAGAACCCCCGAGACTCAGGAGG + Intronic
948461727 2:238132907-238132929 CAGGCCCCCTGGGACAGAGGAGG + Exonic
1169080988 20:2797692-2797714 CAGAGGCCCCGGGCCAGAAGGGG + Intronic
1169085009 20:2821059-2821081 CAGACGCGCCGGGAGGGAGGGGG + Intergenic
1172450108 20:35015977-35015999 GAGACCCCCGGGGACAGATGGGG - Intronic
1176293012 21:5056127-5056149 CAGAAAGCCCGGGACAGAGCAGG + Intergenic
1179478866 21:41665368-41665390 CAGACATGCTGGGACAGAGGGGG + Intergenic
1179563989 21:42235019-42235041 CAGCCTCCCTGGGACAGGGGCGG + Intronic
1179864248 21:44207523-44207545 CAGAAAGCCCGGGACAGAGCAGG - Intergenic
1180181461 21:46120381-46120403 CAGGTCCCCCGGGACAGACGGGG + Intronic
1181696382 22:24594857-24594879 CAGACCCCCCTGCCCAGAGCAGG + Intronic
1182473041 22:30560468-30560490 CAGGCCCCCCGGGCCTCAGGAGG - Intronic
1182516475 22:30861888-30861910 CAGGAGCCCCAGGACAGAGGTGG - Intronic
1183714961 22:39528193-39528215 CAGACCACCCAGGGCAGTGGGGG + Intergenic
1185340337 22:50288126-50288148 CCGAGGCCCCGGGACAGAGCTGG - Intronic
1185344712 22:50306231-50306253 CAGACCCCCCGGGACAGAGGTGG + Intronic
1185398748 22:50605341-50605363 GAGACCCGGCAGGACAGAGGCGG - Intronic
950183004 3:10928222-10928244 CAGGGCCCCTGGCACAGAGGAGG - Intronic
950514167 3:13453398-13453420 TAGACCCCACAGGCCAGAGGAGG + Intergenic
952252783 3:31670979-31671001 CACACCTCCAGGGAGAGAGGAGG + Exonic
953881718 3:46694357-46694379 CAGACCCCCCGGGAGCGGGAGGG + Intergenic
954443199 3:50532971-50532993 GAGACCGACTGGGACAGAGGGGG + Intergenic
954662835 3:52235169-52235191 CAGACCCTGTGGGACAGAGCAGG - Intronic
954838450 3:53491797-53491819 AAGACCCCCTGGGCTAGAGGAGG - Intergenic
956027309 3:64996990-64997012 CAAACTCCCTGGCACAGAGGAGG + Intergenic
961663517 3:128482829-128482851 CAGCCCCACAGTGACAGAGGGGG + Intronic
962309025 3:134312917-134312939 CAGAGCCGCAGGGACAGGGGCGG + Intergenic
964344868 3:155745173-155745195 CATCCCGCCCGGGCCAGAGGAGG - Intergenic
968881193 4:3301034-3301056 CAGACCCCGTGTTACAGAGGAGG - Intronic
968881203 4:3301068-3301090 CAGACCCCGTGTTACAGAGGAGG - Intronic
968881211 4:3301101-3301123 CAGACCCCGTGTTACAGAGGAGG - Intronic
968881220 4:3301134-3301156 CAGACCCCGTGTTACAGAGGAGG - Intronic
968881230 4:3301168-3301190 CAGACCCCGTGTTACAGAGGAGG - Intronic
968881239 4:3301201-3301223 CAGACCCCATGTAACAGAGGAGG - Intronic
968954344 4:3710618-3710640 CAGATTCCCCGGGACAGGGCAGG - Intergenic
969307135 4:6332307-6332329 CATTCCCACAGGGACAGAGGAGG + Intronic
977728572 4:100325464-100325486 CAGACCCCTGGGGAGAGGGGTGG + Intergenic
984652307 4:182283599-182283621 CAGACCATCCTGGACTGAGGAGG - Intronic
984709710 4:182875063-182875085 CAGACAGCCCCGGACATAGGGGG - Intergenic
985374804 4:189323590-189323612 CTGACCCGCAGGGACAGCGGGGG - Intergenic
986360341 5:6971877-6971899 CAGACCCACCAGGACAGAGATGG - Intergenic
988100430 5:26669631-26669653 CTAAACCCCAGGGACAGAGGAGG - Intergenic
990727448 5:58772501-58772523 CAGACCACTATGGACAGAGGTGG + Intronic
993168400 5:84384721-84384743 CAGACCCACCGGCAGACAGGCGG + Exonic
997622494 5:135307863-135307885 CTGGCCCCCCAGGAGAGAGGAGG - Intronic
1002449968 5:179313215-179313237 CACACACACCGAGACAGAGGAGG + Intronic
1002449994 5:179313379-179313401 CACACACACCGAGACAGAGGAGG + Intronic
1002632511 5:180590989-180591011 GCGAGCCCCCGGGACACAGGCGG + Intronic
1002896378 6:1382675-1382697 AAGACCCCCCTGGAGAGAAGGGG + Intergenic
1007063408 6:38964337-38964359 CAGCCCCCCCGGGAGGGAGGTGG - Intronic
1017997208 6:159542392-159542414 CAGACACACCTGGCCAGAGGAGG - Intergenic
1019500289 7:1361169-1361191 CCGGCCCCCTGGGACAGAGCTGG + Intergenic
1019674462 7:2302990-2303012 CACCCCGTCCGGGACAGAGGTGG + Intronic
1019737048 7:2655876-2655898 TAGACCCCACGGGTCTGAGGAGG + Intronic
1019744682 7:2692950-2692972 CAGACCGTCCCAGACAGAGGTGG - Intronic
1019779745 7:2932282-2932304 CAGACCCACCGGGAGAGGCGGGG + Intronic
1019803442 7:3105261-3105283 CAGACCCCTGGGGCCAGAGAAGG - Intergenic
1021916382 7:25437263-25437285 CAGACACCTCAGGACTGAGGAGG + Intergenic
1021960192 7:25862808-25862830 CATACCCCCCGGGAGACAGGCGG - Intergenic
1022603196 7:31781355-31781377 CAGATCCCACAGGGCAGAGGAGG + Intronic
1022685705 7:32594241-32594263 CAGACTCCCAGGGGCAGAGCAGG - Intergenic
1023393747 7:39733518-39733540 GGGATCCCCCGGGGCAGAGGCGG + Intergenic
1024532131 7:50402005-50402027 CAGATCCCCTAGGAAAGAGGAGG + Exonic
1025210903 7:57019214-57019236 CAGACCCCCAGGGTCAGGGCCGG - Intergenic
1025661052 7:63557633-63557655 CAGACCCCCAGGGTCAGGGCCGG + Intergenic
1029420163 7:100468015-100468037 CAGAGCCCCCCGGGCAGAGCAGG + Intronic
1030014351 7:105203682-105203704 CACACCCCCGGAGCCAGAGGAGG - Exonic
1034268209 7:149791287-149791309 CAGCCCCCCTGGGAAAGAAGAGG - Intergenic
1035450465 7:158974088-158974110 CAGACCGCCGGGGACAGCGCGGG - Intergenic
1035630748 8:1104964-1104986 CAGACGCCCTGGAGCAGAGGAGG + Intergenic
1036225983 8:6958010-6958032 ATGACCCCCCGGCCCAGAGGGGG - Intergenic
1036653828 8:10662814-10662836 CAGAGCTCCCAGGACAGGGGAGG - Intronic
1037374181 8:18210604-18210626 CACACCACTGGGGACAGAGGAGG - Intronic
1037890853 8:22623074-22623096 CAGACCACCCGGGCCAGGAGGGG + Intronic
1039462895 8:37761088-37761110 CAGACTCCCAGGAACAGAGATGG - Intergenic
1039845080 8:41320400-41320422 CATACCCCACAGGACAGAGTGGG + Intergenic
1040286661 8:46103911-46103933 CAGCCCGCCTGGGACAAAGGTGG + Intergenic
1040287534 8:46108126-46108148 CAGCACCCCCGGGACACAGCTGG + Intergenic
1040313290 8:46247864-46247886 CAGCCCACCCGGGACAGACCTGG - Intergenic
1040333976 8:46406772-46406794 CAGACCGACCGGGACAGACCTGG - Intergenic
1040341323 8:46442608-46442630 CAGCCCACCCGGGACAGCTGTGG + Intergenic
1045188211 8:99858915-99858937 AAGCCTCCCCGGGACAGCGGAGG - Intronic
1049424783 8:142533166-142533188 CAGGCCCCCAGAGACAGAGACGG + Intronic
1049851037 8:144830293-144830315 CAGACTAGCCGGGACAGAGGGGG - Intronic
1053118055 9:35522925-35522947 CAGTACACCAGGGACAGAGGTGG - Intronic
1053377102 9:37616789-37616811 CAGACCCCTCAGGGCAGAGTTGG + Intronic
1055772811 9:79735728-79735750 CATACCTCCCTGGACAGTGGAGG - Intergenic
1056768827 9:89462161-89462183 CAGACCACCCTGGGCAGAGAGGG - Intronic
1057049599 9:91913670-91913692 CAGACTGGCCGGAACAGAGGAGG - Intronic
1060886815 9:127160418-127160440 CAAACCCCCAGGGCCAGAGTGGG - Intronic
1061387980 9:130301639-130301661 CTCCCCCCCCGGGACAGATGTGG + Intronic
1061821937 9:133233805-133233827 CGGAACCCCAGGGACAGAGGAGG - Intergenic
1061878155 9:133555155-133555177 CAGAGACACCGGCACAGAGGAGG - Intronic
1062057336 9:134475387-134475409 CAGATCCCCGGGGAAGGAGGAGG + Intergenic
1062096814 9:134707879-134707901 CAGACTTCCCGGCACACAGGCGG + Intronic
1062237362 9:135516709-135516731 CGGAACCCCGGGGACAGAGGAGG + Intergenic
1062306296 9:135908458-135908480 GAGACACCCCGTGCCAGAGGCGG + Intergenic
1062422094 9:136487667-136487689 CAGGCCCCCAGGGCCACAGGAGG + Intergenic
1062433704 9:136536801-136536823 CAGGCCCCCCTGGGCAGGGGAGG - Intronic
1062447081 9:136599561-136599583 CAGACCCCACGGGAGACAAGGGG - Intergenic
1062484051 9:136765338-136765360 CAGACCCCTCTGGTCAGGGGCGG + Intronic
1062645739 9:137547271-137547293 CCAACCCCCCGGGCCAGAGTCGG + Intronic
1192150054 X:68706532-68706554 CTGTCCCCCAGGGAGAGAGGTGG + Intronic
1200005982 X:153084532-153084554 CAGACACTCCGGGGCAGAGGGGG - Intergenic
1200228681 X:154433167-154433189 CAGACCCCACTTGGCAGAGGGGG + Intronic
1202110049 Y:21408698-21408720 GAGACACCCCGGGTCCGAGGGGG - Intergenic