ID: 1185344712

View in Genome Browser
Species Human (GRCh38)
Location 22:50306231-50306253
Sequence CAGACCCCCCGGGACAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185344703_1185344712 -1 Left 1185344703 22:50306209-50306231 CCTGGCCAGACCTCAGGCCTCCC No data
Right 1185344712 22:50306231-50306253 CAGACCCCCCGGGACAGAGGTGG No data
1185344702_1185344712 0 Left 1185344702 22:50306208-50306230 CCCTGGCCAGACCTCAGGCCTCC No data
Right 1185344712 22:50306231-50306253 CAGACCCCCCGGGACAGAGGTGG No data
1185344697_1185344712 23 Left 1185344697 22:50306185-50306207 CCTCCTCTACTGGGGCAAGGAAC No data
Right 1185344712 22:50306231-50306253 CAGACCCCCCGGGACAGAGGTGG No data
1185344698_1185344712 20 Left 1185344698 22:50306188-50306210 CCTCTACTGGGGCAAGGAACCCC No data
Right 1185344712 22:50306231-50306253 CAGACCCCCCGGGACAGAGGTGG No data
1185344696_1185344712 24 Left 1185344696 22:50306184-50306206 CCCTCCTCTACTGGGGCAAGGAA No data
Right 1185344712 22:50306231-50306253 CAGACCCCCCGGGACAGAGGTGG No data
1185344704_1185344712 -6 Left 1185344704 22:50306214-50306236 CCAGACCTCAGGCCTCCCAGACC No data
Right 1185344712 22:50306231-50306253 CAGACCCCCCGGGACAGAGGTGG No data
1185344701_1185344712 1 Left 1185344701 22:50306207-50306229 CCCCTGGCCAGACCTCAGGCCTC No data
Right 1185344712 22:50306231-50306253 CAGACCCCCCGGGACAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185344712 Original CRISPR CAGACCCCCCGGGACAGAGG TGG Intronic