ID: 1185344729

View in Genome Browser
Species Human (GRCh38)
Location 22:50306271-50306293
Sequence TGGGAGGACTCAGATGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185344717_1185344729 10 Left 1185344717 22:50306238-50306260 CCCGGGACAGAGGTGGGCCCCCC No data
Right 1185344729 22:50306271-50306293 TGGGAGGACTCAGATGTGCCAGG No data
1185344715_1185344729 12 Left 1185344715 22:50306236-50306258 CCCCCGGGACAGAGGTGGGCCCC No data
Right 1185344729 22:50306271-50306293 TGGGAGGACTCAGATGTGCCAGG No data
1185344711_1185344729 18 Left 1185344711 22:50306230-50306252 CCAGACCCCCCGGGACAGAGGTG No data
Right 1185344729 22:50306271-50306293 TGGGAGGACTCAGATGTGCCAGG No data
1185344710_1185344729 19 Left 1185344710 22:50306229-50306251 CCCAGACCCCCCGGGACAGAGGT No data
Right 1185344729 22:50306271-50306293 TGGGAGGACTCAGATGTGCCAGG No data
1185344716_1185344729 11 Left 1185344716 22:50306237-50306259 CCCCGGGACAGAGGTGGGCCCCC No data
Right 1185344729 22:50306271-50306293 TGGGAGGACTCAGATGTGCCAGG No data
1185344724_1185344729 -8 Left 1185344724 22:50306256-50306278 CCCCCATAGGTACCGTGGGAGGA No data
Right 1185344729 22:50306271-50306293 TGGGAGGACTCAGATGTGCCAGG No data
1185344722_1185344729 -7 Left 1185344722 22:50306255-50306277 CCCCCCATAGGTACCGTGGGAGG No data
Right 1185344729 22:50306271-50306293 TGGGAGGACTCAGATGTGCCAGG No data
1185344708_1185344729 22 Left 1185344708 22:50306226-50306248 CCTCCCAGACCCCCCGGGACAGA No data
Right 1185344729 22:50306271-50306293 TGGGAGGACTCAGATGTGCCAGG No data
1185344726_1185344729 -10 Left 1185344726 22:50306258-50306280 CCCATAGGTACCGTGGGAGGACT No data
Right 1185344729 22:50306271-50306293 TGGGAGGACTCAGATGTGCCAGG No data
1185344705_1185344729 29 Left 1185344705 22:50306219-50306241 CCTCAGGCCTCCCAGACCCCCCG No data
Right 1185344729 22:50306271-50306293 TGGGAGGACTCAGATGTGCCAGG No data
1185344725_1185344729 -9 Left 1185344725 22:50306257-50306279 CCCCATAGGTACCGTGGGAGGAC No data
Right 1185344729 22:50306271-50306293 TGGGAGGACTCAGATGTGCCAGG No data
1185344718_1185344729 9 Left 1185344718 22:50306239-50306261 CCGGGACAGAGGTGGGCCCCCCA No data
Right 1185344729 22:50306271-50306293 TGGGAGGACTCAGATGTGCCAGG No data
1185344714_1185344729 13 Left 1185344714 22:50306235-50306257 CCCCCCGGGACAGAGGTGGGCCC No data
Right 1185344729 22:50306271-50306293 TGGGAGGACTCAGATGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185344729 Original CRISPR TGGGAGGACTCAGATGTGCC AGG Intronic