ID: 1185345387

View in Genome Browser
Species Human (GRCh38)
Location 22:50308400-50308422
Sequence GCACCTTGGGATGCTGCACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185345381_1185345387 -8 Left 1185345381 22:50308385-50308407 CCCTGGCCTCCAGCAGCACCTTG No data
Right 1185345387 22:50308400-50308422 GCACCTTGGGATGCTGCACCCGG No data
1185345376_1185345387 16 Left 1185345376 22:50308361-50308383 CCTGGAGATGGCCTCCCAGCACA No data
Right 1185345387 22:50308400-50308422 GCACCTTGGGATGCTGCACCCGG No data
1185345378_1185345387 5 Left 1185345378 22:50308372-50308394 CCTCCCAGCACATCCCTGGCCTC No data
Right 1185345387 22:50308400-50308422 GCACCTTGGGATGCTGCACCCGG No data
1185345382_1185345387 -9 Left 1185345382 22:50308386-50308408 CCTGGCCTCCAGCAGCACCTTGG No data
Right 1185345387 22:50308400-50308422 GCACCTTGGGATGCTGCACCCGG No data
1185345380_1185345387 1 Left 1185345380 22:50308376-50308398 CCAGCACATCCCTGGCCTCCAGC No data
Right 1185345387 22:50308400-50308422 GCACCTTGGGATGCTGCACCCGG No data
1185345379_1185345387 2 Left 1185345379 22:50308375-50308397 CCCAGCACATCCCTGGCCTCCAG No data
Right 1185345387 22:50308400-50308422 GCACCTTGGGATGCTGCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185345387 Original CRISPR GCACCTTGGGATGCTGCACC CGG Intergenic
No off target data available for this crispr