ID: 1185346047

View in Genome Browser
Species Human (GRCh38)
Location 22:50311287-50311309
Sequence GTTCACCCCTTACCAAGGAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185346039_1185346047 28 Left 1185346039 22:50311236-50311258 CCTGCAGGTGTCACGGGGGGAGC 0: 1
1: 0
2: 1
3: 10
4: 120
Right 1185346047 22:50311287-50311309 GTTCACCCCTTACCAAGGAAAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1185346044_1185346047 -1 Left 1185346044 22:50311265-50311287 CCCAGAGGTGGCTCTTAGGGACG 0: 1
1: 0
2: 0
3: 10
4: 66
Right 1185346047 22:50311287-50311309 GTTCACCCCTTACCAAGGAAAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1185346045_1185346047 -2 Left 1185346045 22:50311266-50311288 CCAGAGGTGGCTCTTAGGGACGT 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1185346047 22:50311287-50311309 GTTCACCCCTTACCAAGGAAAGG 0: 1
1: 0
2: 0
3: 6
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185346047 Original CRISPR GTTCACCCCTTACCAAGGAA AGG Exonic
900542973 1:3213217-3213239 TTTCCCCCCTCACCACGGAATGG - Intronic
906758715 1:48349853-48349875 GTTCACCATTCACCAATGAAGGG + Intronic
906996446 1:50799699-50799721 GTCCATCCCTTAACAAAGAAAGG - Intronic
907068339 1:51509846-51509868 GTTCAGCTATAACCAAGGAATGG + Intronic
907285371 1:53376426-53376448 CTTCACCCCTGTCCATGGAAGGG - Intergenic
908858067 1:68451709-68451731 TTCCACCCTTTACCAAGAAAAGG + Intergenic
913369686 1:118084139-118084161 GTTCACCCCCTACTCAGGAAGGG + Intronic
913699123 1:121357106-121357128 GTTCACATCATGCCAAGGAATGG + Intronic
914138423 1:144922939-144922961 GTTCACATCATGCCAAGGAATGG - Intronic
920486533 1:206375818-206375840 GTTCACATCATGCCAAGGAATGG + Intronic
922199078 1:223386045-223386067 GTTCTCCCCTTTGCATGGAATGG - Intergenic
1066296340 10:34057074-34057096 GTGATCCCCTTAGCAAGGAAAGG - Intergenic
1077976530 11:7252813-7252835 TCTCACCCCATACCAAGGAAAGG - Intronic
1078661612 11:13292023-13292045 GTTCACTCCATTCCTAGGAAAGG - Intronic
1083476262 11:62917536-62917558 GTTCACCCCATTCCACAGAAGGG - Intronic
1086272377 11:85082993-85083015 TTTAGCCACTTACCAAGGAATGG + Intronic
1087616174 11:100488931-100488953 TGTCACCCCTTTCCTAGGAAAGG - Intergenic
1090416269 11:126542653-126542675 GCTCACACCTTATCTAGGAAGGG + Intronic
1090737145 11:129619849-129619871 GTGCACCCCTTCCCGATGAAAGG + Intergenic
1095887617 12:47205555-47205577 GTTCAGCCTATACCCAGGAATGG + Intronic
1104023742 12:125011244-125011266 GGTCAGCCCTTACAAGGGAAGGG + Intronic
1105501781 13:20979301-20979323 GTTCACCCCTCAGCAATGAGGGG - Intronic
1106220473 13:27742561-27742583 GTCCTCTCCTGACCAAGGAAAGG + Intergenic
1106439601 13:29754321-29754343 GTTCAGCCTATACCCAGGAATGG + Intergenic
1107205794 13:37786057-37786079 AATCAACACTTACCAAGGAATGG + Intronic
1107374718 13:39789781-39789803 GTACACCCCTGGACAAGGAAGGG - Intronic
1108770361 13:53693415-53693437 CTTCACTCATTACCAAGGGAAGG - Intergenic
1108888569 13:55223659-55223681 GTTCCTGCCCTACCAAGGAAAGG - Intergenic
1113996192 14:16076280-16076302 GTTCAACTCTGATCAAGGAATGG - Intergenic
1120134073 14:80844296-80844318 TTTCAGCCATGACCAAGGAAAGG + Intronic
1120192794 14:81454262-81454284 GCCCACCCCTTAGCCAGGAAGGG - Intergenic
1120267902 14:82274869-82274891 GTTCTTCCCTTACCAGTGAATGG + Intergenic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1122350140 14:101084281-101084303 GTCCACCCCAAACCCAGGAACGG + Intergenic
1127596172 15:60484551-60484573 GTTCACCCCGAATCAAGCAAAGG - Intergenic
1129575493 15:76739337-76739359 GTTCTCAACTTACTAAGGAAAGG - Intronic
1129976026 15:79822539-79822561 GTTCACCCTTTCCCAAGAAGAGG - Intergenic
1139967054 16:70751567-70751589 CTGCACCCCTCACGAAGGAAGGG - Intronic
1143130427 17:4673930-4673952 GTTCTCCCCTTCCCATGGGATGG + Intronic
1144310684 17:14011467-14011489 ATTCATCCCCTGCCAAGGAATGG + Intergenic
1144560007 17:16313458-16313480 GTTCTCTCCTTCCCAAGGGAAGG + Intronic
1149869648 17:60170188-60170210 GTTCTCTCCTTTCCCAGGAAAGG + Intronic
1156161041 18:34358557-34358579 GTTCACAACTTAATAAGGAAAGG + Intergenic
1159889161 18:73938539-73938561 GTTCAATCCTTACTGAGGAAGGG - Intergenic
1162456818 19:10790122-10790144 GTTCACGCCTTACAAGAGAACGG + Intronic
1163065134 19:14786743-14786765 GTTCACCCCTCCCCCAGGCATGG - Intergenic
925944806 2:8850984-8851006 GTTCACCCCTCACAAAGGGACGG + Intergenic
937228437 2:120383171-120383193 GTTTACCCATTAGCAAGGGAAGG + Intergenic
938251611 2:129820110-129820132 GGTCACCCCTTGACAAGGAGGGG - Intergenic
938535991 2:132248024-132248046 GTTCAACTCTGATCAAGGAATGG + Intronic
944450328 2:199835894-199835916 ATTCACCCCTTACTAACAAAGGG - Intronic
946121679 2:217521374-217521396 GTTCACCACTCCACAAGGAAAGG + Intronic
946386422 2:219387057-219387079 GGCCACCGCTTACCATGGAAAGG + Exonic
948760229 2:240185700-240185722 ATTCACCCTTTATCTAGGAAAGG - Intergenic
1171864025 20:30463938-30463960 GTTCAACTCTGATCAAGGAATGG + Intergenic
1173000568 20:39102487-39102509 ATGCACCCCTCACCAAGGGAAGG + Intergenic
1179173994 21:38994150-38994172 GTCCACCCATTCCCAAGAAAAGG + Intergenic
1180310867 22:11230867-11230889 GTTCAACTCTGATCAAGGAATGG + Intergenic
1181053478 22:20248560-20248582 CTTCACACCTTGCCAAGGTACGG - Intronic
1181946504 22:26521727-26521749 GTCCATCCCTTACCCTGGAAGGG + Intergenic
1185346047 22:50311287-50311309 GTTCACCCCTTACCAAGGAAAGG + Exonic
950091583 3:10299510-10299532 GGTCTCCTCTTACCCAGGAATGG + Intronic
950967415 3:17155808-17155830 GCTCACCCCCTACCAAGGCCAGG - Intergenic
951263240 3:20536762-20536784 GTTCATGCCTCCCCAAGGAATGG + Intergenic
963235864 3:142955251-142955273 GTTCACCCATTTCCAAACAAAGG - Intronic
966834142 3:184036489-184036511 GTTCACCTCTGTCCATGGAAGGG - Exonic
970609975 4:17716190-17716212 GTTCACCACTGACCATGCAAGGG + Intronic
975439213 4:74391552-74391574 GTACACCCCTGGCCAAAGAAGGG + Intergenic
982764554 4:159330022-159330044 GACCACTCCTTCCCAAGGAAAGG + Intronic
983688463 4:170438512-170438534 GTTCCCCCCACACCAAGGGAAGG - Intergenic
986549362 5:8935614-8935636 ACTCACCCCTTGCCTAGGAAGGG - Intergenic
987053181 5:14165687-14165709 CTACATCCCTTCCCAAGGAAAGG - Intronic
987278619 5:16389249-16389271 GCTCACTCCTTCCCAAGGGAGGG + Intergenic
988520381 5:31940177-31940199 GTTCCCCCGTCACCAAGGAAAGG - Intronic
996889925 5:128406436-128406458 GTTCTCTACTTAGCAAGGAAAGG - Intronic
999307536 5:150529880-150529902 GTTCACTCCTGACCAAGGCAGGG - Intronic
1006163855 6:32053318-32053340 GTTCACCCATCACCAGAGAAAGG + Intronic
1008311070 6:49974815-49974837 GTTTACCCCTTCTGAAGGAAAGG - Intergenic
1017675150 6:156805503-156805525 GTTTACACTTCACCAAGGAAGGG + Intronic
1019513882 7:1431360-1431382 GTTCACCCCTTGCGAAGCCAGGG - Intronic
1023437933 7:40157381-40157403 GTTCAACCCTTACCTATCAATGG + Intronic
1030946433 7:115727591-115727613 GCTCAGCTCTTAACAAGGAAGGG - Intergenic
1032165802 7:129543818-129543840 GTTCCCCCCTTACCCAGGGAAGG + Intergenic
1038264442 8:26027065-26027087 GTTTACCCATTTCCGAGGAATGG + Intronic
1041421062 8:57667426-57667448 TTTCACCCTTCACCAAGAAAGGG + Intergenic
1048361922 8:133704916-133704938 GTTCATCCCATGCCAATGAAGGG + Intergenic
1049196106 8:141316475-141316497 GTTCACAACTTGCAAAGGAACGG + Intergenic
1053108698 9:35438097-35438119 GGTCACCACATCCCAAGGAAGGG + Intergenic
1057790629 9:98122474-98122496 GGTCCCTCCTTACCAAGGAGGGG - Exonic
1060186733 9:121568252-121568274 GCTCAGCCCTTTCCAAGGAGAGG + Intronic
1061327778 9:129874675-129874697 GTGCACTCCTTGGCAAGGAAGGG - Exonic
1186891791 X:13966261-13966283 GCTCACCCCTGCCCAAGGCACGG + Intergenic