ID: 1185346154

View in Genome Browser
Species Human (GRCh38)
Location 22:50311736-50311758
Sequence CCCAACAGGCTGCCCAGGAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 260}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185346154_1185346167 15 Left 1185346154 22:50311736-50311758 CCTGTCCTGGGCAGCCTGTTGGG 0: 1
1: 0
2: 4
3: 24
4: 260
Right 1185346167 22:50311774-50311796 CACACAGCGCAGGGGGGTCGGGG 0: 1
1: 0
2: 0
3: 13
4: 171
1185346154_1185346161 6 Left 1185346154 22:50311736-50311758 CCTGTCCTGGGCAGCCTGTTGGG 0: 1
1: 0
2: 4
3: 24
4: 260
Right 1185346161 22:50311765-50311787 GAAGCATCACACACAGCGCAGGG 0: 1
1: 0
2: 0
3: 7
4: 129
1185346154_1185346164 9 Left 1185346154 22:50311736-50311758 CCTGTCCTGGGCAGCCTGTTGGG 0: 1
1: 0
2: 4
3: 24
4: 260
Right 1185346164 22:50311768-50311790 GCATCACACACAGCGCAGGGGGG 0: 1
1: 1
2: 0
3: 9
4: 133
1185346154_1185346165 13 Left 1185346154 22:50311736-50311758 CCTGTCCTGGGCAGCCTGTTGGG 0: 1
1: 0
2: 4
3: 24
4: 260
Right 1185346165 22:50311772-50311794 CACACACAGCGCAGGGGGGTCGG 0: 1
1: 0
2: 0
3: 15
4: 234
1185346154_1185346166 14 Left 1185346154 22:50311736-50311758 CCTGTCCTGGGCAGCCTGTTGGG 0: 1
1: 0
2: 4
3: 24
4: 260
Right 1185346166 22:50311773-50311795 ACACACAGCGCAGGGGGGTCGGG 0: 1
1: 0
2: 2
3: 19
4: 214
1185346154_1185346162 7 Left 1185346154 22:50311736-50311758 CCTGTCCTGGGCAGCCTGTTGGG 0: 1
1: 0
2: 4
3: 24
4: 260
Right 1185346162 22:50311766-50311788 AAGCATCACACACAGCGCAGGGG 0: 1
1: 0
2: 0
3: 19
4: 131
1185346154_1185346168 16 Left 1185346154 22:50311736-50311758 CCTGTCCTGGGCAGCCTGTTGGG 0: 1
1: 0
2: 4
3: 24
4: 260
Right 1185346168 22:50311775-50311797 ACACAGCGCAGGGGGGTCGGGGG 0: 1
1: 0
2: 1
3: 8
4: 187
1185346154_1185346170 28 Left 1185346154 22:50311736-50311758 CCTGTCCTGGGCAGCCTGTTGGG 0: 1
1: 0
2: 4
3: 24
4: 260
Right 1185346170 22:50311787-50311809 GGGGTCGGGGGCCAACAGATGGG 0: 1
1: 0
2: 0
3: 10
4: 106
1185346154_1185346169 27 Left 1185346154 22:50311736-50311758 CCTGTCCTGGGCAGCCTGTTGGG 0: 1
1: 0
2: 4
3: 24
4: 260
Right 1185346169 22:50311786-50311808 GGGGGTCGGGGGCCAACAGATGG 0: 1
1: 0
2: 1
3: 38
4: 432
1185346154_1185346163 8 Left 1185346154 22:50311736-50311758 CCTGTCCTGGGCAGCCTGTTGGG 0: 1
1: 0
2: 4
3: 24
4: 260
Right 1185346163 22:50311767-50311789 AGCATCACACACAGCGCAGGGGG 0: 1
1: 0
2: 1
3: 8
4: 136
1185346154_1185346160 5 Left 1185346154 22:50311736-50311758 CCTGTCCTGGGCAGCCTGTTGGG 0: 1
1: 0
2: 4
3: 24
4: 260
Right 1185346160 22:50311764-50311786 GGAAGCATCACACACAGCGCAGG 0: 1
1: 0
2: 0
3: 6
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185346154 Original CRISPR CCCAACAGGCTGCCCAGGAC AGG (reversed) Exonic
900000688 1:13289-13311 GCCAACAGCGTGTCCAGGACAGG - Intergenic
900020405 1:183808-183830 GCCAACAGCATGTCCAGGACAGG - Intergenic
900384690 1:2404980-2405002 CCCAGCAGGCCCCCCAGGAGAGG + Exonic
900999936 1:6143878-6143900 CCCAAGAGGCTGCTCAAGAAGGG - Exonic
901631288 1:10649400-10649422 TTCAGCAGGCTGCCCAGGCCAGG + Exonic
901633900 1:10660900-10660922 CCCAACCTGCCTCCCAGGACAGG + Intronic
902816021 1:18917259-18917281 CCCACCAGGCCGCCCAGGGCAGG - Intronic
903153711 1:21430290-21430312 GCCAACTGGCAGCCCAGGAGTGG + Intergenic
903861029 1:26364687-26364709 CCCAACCGACTCCCCAGGCCTGG - Exonic
904012148 1:27395889-27395911 CCCAACAGGCCCCCCAGGCCTGG - Intergenic
904038504 1:27571341-27571363 CCCATCAGACTCCCCAGGGCAGG - Intronic
904627214 1:31813950-31813972 CCCAGGAGGCTGCCCCAGACTGG - Exonic
904726108 1:32549513-32549535 CCCAACAGGCCCCCCAGGGAGGG + Intronic
905457793 1:38100488-38100510 CCCAGGAGGCTGCCAGGGACAGG - Intergenic
905631466 1:39521390-39521412 CCCAGCAGGCCGGCCAGGCCAGG - Exonic
905666288 1:39764781-39764803 CCCAGCAGGCCGGCCAGGCCAGG + Exonic
905943584 1:41883662-41883684 CCCACCAGGCTGCCTCTGACAGG - Intronic
907524781 1:55047794-55047816 GGCCACAGGCTGCCCAGGCCGGG - Intronic
910297283 1:85661951-85661973 CCCATGAGGCTGCCCAGAGCAGG - Intronic
910437952 1:87224873-87224895 GCCTACACCCTGCCCAGGACTGG - Intergenic
912383666 1:109260840-109260862 CCAAACAGGGTGCCCATGAAGGG + Intronic
913959235 1:143326575-143326597 CCCAACCGGCCACCCAAGACGGG + Intergenic
914053552 1:144151955-144151977 CCCAACCGGCCACCCAAGACGGG + Intergenic
914125645 1:144814586-144814608 CCCAACCGGCCACCCAAGACGGG - Intergenic
914343104 1:146776785-146776807 CCCCACAGAGTGACCAGGACCGG + Intergenic
916802247 1:168226202-168226224 CCCCGCAGGCTTCCCAGGCCCGG - Intronic
918232756 1:182550869-182550891 CCCAACAAACTGCCCATGCCAGG + Intronic
919746407 1:201011719-201011741 CCTCAGAGGCTGCCCAGGCCAGG - Intronic
919977660 1:202623323-202623345 CCCAGCAGGCAGCTCAGGGCTGG - Intronic
920083098 1:203391030-203391052 CTCAACATGTTGCCCAGGATAGG + Intergenic
920110329 1:203582944-203582966 ACCAGCAGGCTGGCCAGGAAGGG - Intergenic
922582501 1:226709329-226709351 CCAGACAGGCAGCCCAGGGCAGG - Intronic
922886906 1:229027411-229027433 TTTAACAGGCTGCCCAGGCCCGG + Intergenic
1063672521 10:8110942-8110964 CCCATCAGTCTCCCCAGGGCCGG - Intergenic
1066240785 10:33532974-33532996 CACAACTGGCTTTCCAGGACCGG + Intergenic
1067542276 10:47164708-47164730 CCCACCATGCTGCCCAGATCTGG + Intergenic
1069728667 10:70597544-70597566 CCCACCAGGCTGCTCAGGGCTGG - Exonic
1070398624 10:76033775-76033797 GCCAAAAGGCTTCTCAGGACTGG - Intronic
1071430483 10:85602786-85602808 CCCAACAGGCTGACCAGGCCTGG - Intronic
1072475883 10:95759320-95759342 CCCAACAGGGTGCCCTGGCATGG - Intronic
1072710683 10:97713949-97713971 CCCAGCGGGCTGCGCAGGAAGGG - Exonic
1073337100 10:102717932-102717954 CCCAGCATGCTGCAAAGGACAGG + Intronic
1073480247 10:103782004-103782026 TCCCAGAGGCTGCCCAGGAATGG - Intronic
1076221268 10:128734909-128734931 CCCACCCGGCTGCCCTGCACCGG - Intergenic
1076514015 10:131033087-131033109 CTCAGCAGCCTGCCCAGCACTGG - Intergenic
1076521186 10:131082391-131082413 CCCTGCAGGCTGCCCAGCATGGG + Intergenic
1076737756 10:132466298-132466320 CCAGACAGGCTGCCAAGGCCTGG + Intergenic
1076796282 10:132799895-132799917 CCCCACAGGCTGGCCAGGGCTGG - Intergenic
1077234158 11:1471945-1471967 GCTAACAGCCTGGCCAGGACAGG + Intronic
1077302940 11:1855504-1855526 CCCCTCAGACTGCCCGGGACGGG + Intronic
1077735544 11:4786798-4786820 CCTAACAGGCTTCCCTGGGCTGG + Intronic
1078101156 11:8331100-8331122 CCCAACAGGTTCTCCAGGACTGG + Intergenic
1079710992 11:23681103-23681125 CCCACCTGGCTGCCCAAGAGTGG + Intergenic
1083772445 11:64875843-64875865 CCCAGCAGGAAGGCCAGGACTGG - Intronic
1084007829 11:66332538-66332560 GCCCACAGGCTGCCCACCACTGG - Exonic
1084412931 11:69014432-69014454 CCCAGCTGGCTGCCCTGGAGAGG - Intergenic
1085242995 11:75074038-75074060 CCCAACAGGCAGACCAGGCTTGG + Intergenic
1085350160 11:75793125-75793147 CCCAACACGATGCCCAGGCCCGG - Intronic
1085403295 11:76247168-76247190 GCCAACAGGCTGCACTGGGCAGG + Intergenic
1088807304 11:113364323-113364345 CACAGCAGGCTTCCCAGGAGAGG + Intronic
1088889276 11:114032004-114032026 CCCAGCAGGCTGCCAGGGCCAGG - Intergenic
1089208564 11:116785197-116785219 CCCAACACCCTGCCCTGGAGTGG + Intronic
1090800977 11:130171941-130171963 ACCGACAGACTGCCCAGGCCAGG - Intronic
1091373787 12:13416-13438 GCCAACAGCCTGTCCAGGACAGG - Intergenic
1091785561 12:3241663-3241685 CCCACCATGCTGACCATGACTGG - Intronic
1091816628 12:3443753-3443775 CCCTAGAGGCTGCACAGGCCTGG + Intronic
1092126358 12:6077625-6077647 CCCAACAGGCCGTCTGGGACTGG - Intronic
1096094203 12:48923982-48924004 CCAAACAGGCTGGCCAGCAAAGG + Intronic
1096124448 12:49109477-49109499 CCAATCAGGCTGCCCAGGGCTGG + Intronic
1096472938 12:51890281-51890303 CGGTGCAGGCTGCCCAGGACAGG - Intronic
1096784187 12:54007968-54007990 CCAGGCAGGCTGCCCAGGCCAGG - Intronic
1099259025 12:80353023-80353045 ACCAACAGGCAGCCCAAGTCTGG - Intronic
1100523864 12:95402159-95402181 CCCCACGTTCTGCCCAGGACAGG + Intergenic
1102651796 12:114447619-114447641 CCAAACAAGCCGCTCAGGACTGG - Intergenic
1103834349 12:123807251-123807273 TCCAACAGGCAGCACAGGGCAGG - Intronic
1104707110 12:130955651-130955673 CACAACAGGCTTCCCAGCAGGGG - Intronic
1107071297 13:36272474-36272496 CCTCACAGACTTCCCAGGACAGG - Intronic
1108404170 13:50082820-50082842 CGCAACAGGCAGCTTAGGACCGG - Intronic
1113374382 13:109750629-109750651 CACAACAGGAAGCCCAGGGCTGG - Intergenic
1117549894 14:56824489-56824511 CCCAACAGGTTGCCCAAGGAGGG - Intergenic
1120172471 14:81259406-81259428 CGAAGCAGGCTGCCCAGGAATGG - Intergenic
1121218289 14:92265289-92265311 CCCATCAGGGTGGCCGGGACAGG + Intergenic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1121608121 14:95256223-95256245 CCCAACTGGGTGCCGAGGAGTGG - Intronic
1121655608 14:95593443-95593465 CCCAGCAGCCAGCCCAGCACAGG - Intergenic
1122017117 14:98805659-98805681 CCCCACATGCTGCCCTGGCCTGG + Intergenic
1122517667 14:102319983-102320005 CCCAACAGGCCGCCCTGCAGCGG + Exonic
1123168308 14:106347610-106347632 CACATCAGGTTGCCCAGGAATGG - Intergenic
1123170935 14:106372302-106372324 CTCATCAGGCTACCCAGGAATGG - Intergenic
1124493310 15:30171687-30171709 CCCAGCAGGCAGCTCAGGGCTGG - Intergenic
1124750224 15:32366638-32366660 CCCAGCAGGCAGCTCAGGGCTGG + Intergenic
1129692860 15:77723679-77723701 CCCTCCAGGATGCCCAGGCCTGG - Intronic
1129879722 15:78998685-78998707 CCCAGCAGCCTGCCCAGGGAGGG + Intronic
1131023015 15:89115705-89115727 CCCCACAGGCTCCCCAGTGCTGG - Intronic
1131718401 15:95139479-95139501 CCCAAGATACTGCCCAAGACTGG + Intergenic
1132452819 15:101977656-101977678 GCCAACAGCGTGTCCAGGACAGG + Intergenic
1132454079 16:12970-12992 GCCAACAGCCTGTCCAGGACAGG - Intergenic
1132534641 16:472033-472055 GGCAGCAGGCTGACCAGGACTGG - Intronic
1132935234 16:2476649-2476671 CCCCACAGCCTGGCCAGGGCCGG + Intronic
1132939539 16:2499999-2500021 CCCAACAGTGTCCCCAGGGCAGG - Intronic
1133022921 16:2974712-2974734 TCCAAGAGGCAGCCCTGGACTGG - Intronic
1133129690 16:3669084-3669106 CCCATCACCCTGCCCAGGAGTGG - Intronic
1134537254 16:15035824-15035846 ACCAACATGCTCCCCAGGCCGGG - Intronic
1136895333 16:33993001-33993023 CCCACCAGCCTGCCCCCGACTGG + Intergenic
1137702540 16:50507271-50507293 CCCAACCAGGTGCCCAGCACAGG + Intergenic
1139990887 16:70938543-70938565 CCCCACAGAGTGACCAGGACCGG - Intronic
1140098631 16:71895776-71895798 CGCAGGAGGCTGCCCAGGCCTGG + Intronic
1141649806 16:85386867-85386889 CCCAAGAGGCACCCCAGGAATGG - Intergenic
1142130982 16:88431356-88431378 CCCAGCAGGCTGCCCACACCTGG - Exonic
1142897692 17:2992565-2992587 CAAAACAGGCTGGCCAGGTCTGG - Intronic
1143965375 17:10753116-10753138 CCCAAGGGGCTGGCCAGGAAGGG + Intergenic
1146482358 17:33214854-33214876 CCCAACAGACTTGCCAGGAAAGG + Intronic
1148482314 17:47968025-47968047 ACCAACAGGCTGGGCAGAACAGG - Intronic
1149649388 17:58267531-58267553 CCCAAGAGGCAGGCCAGGAGAGG - Exonic
1149996912 17:61410418-61410440 CCCAACAGGCTGCCCACCTTGGG + Intergenic
1150250464 17:63701595-63701617 CCCGGCACCCTGCCCAGGACGGG + Intergenic
1150807506 17:68330750-68330772 CCCAATGGGCTTCCCAGGCCAGG - Intronic
1151970176 17:77453742-77453764 CCCAGGAGGCTGGCCAGGGCTGG - Intronic
1152079153 17:78175745-78175767 CCCACGAGGCTCCCCAGGCCGGG + Intronic
1152879283 17:82806251-82806273 CAGAACAGGCAGCCCAGGTCAGG - Intronic
1154210936 18:12377647-12377669 CCCACCCGGCTGCCCAGGCTCGG - Intergenic
1154346061 18:13544505-13544527 CCCATCAGTCGGCCCAGGACTGG + Intronic
1160576200 18:79855315-79855337 GCCAACACCCTGCACAGGACGGG - Intergenic
1160808955 19:1004721-1004743 CCCCACAGGGTGCCCAGGTCTGG + Exonic
1161272687 19:3398694-3398716 CCCCACAGACAGCCCGGGACAGG + Intronic
1162020601 19:7866771-7866793 CCCCGCTGGCTGCCCAGGTCAGG + Intergenic
1162895499 19:13762842-13762864 CAGAGGAGGCTGCCCAGGACCGG + Exonic
1164147582 19:22521443-22521465 CCCCCCAGCCTGCCCAAGACAGG - Intronic
1164159027 19:22614670-22614692 CCCCTCAGTCTGCCCAAGACAGG + Intergenic
1166391372 19:42410656-42410678 CCCAGCAGGCGGCCCAGGGCCGG + Exonic
1167528041 19:49997556-49997578 CCCACCAGGATGCCAAGGATGGG - Exonic
1168269699 19:55242680-55242702 CCCGGAAGGCTCCCCAGGACAGG + Intronic
1168649624 19:58085132-58085154 TCCAGCAGCCTGCCCCGGACAGG - Exonic
1202692949 1_KI270712v1_random:104376-104398 CCCAACCGGCCACCCAAGACGGG + Intergenic
925602837 2:5626625-5626647 TCCAAGAGGCTGCCCTGCACAGG - Intergenic
925820935 2:7799423-7799445 GCAAACAGGCTGCACAGCACAGG + Intergenic
927110178 2:19858932-19858954 CCCGTCAGGCCGCCCAGGCCAGG + Intergenic
927214748 2:20661940-20661962 CCCCATAGGATGCCCAGGGCTGG - Intergenic
927675551 2:25103496-25103518 CCCCACAGGCTGCCAACGTCTGG - Intronic
929458856 2:42086404-42086426 CCCAACACACAGCCCAGGACTGG + Intergenic
932835166 2:75029300-75029322 TCCAACAGGCTAACCAGGGCTGG + Intergenic
933111526 2:78407931-78407953 CCCTACAGGCTGCTCATGGCAGG - Intergenic
933953449 2:87349586-87349608 CCCAACCGGCCACCCAAGACGGG - Intergenic
934237655 2:90245835-90245857 CCCAACCGGCCACCCAAGACGGG - Intergenic
934275545 2:91570895-91570917 CCCAACCGGCCACCCAAGACGGG + Intergenic
934563953 2:95328164-95328186 CCCACCAGCTTCCCCAGGACTGG + Intronic
934618452 2:95789811-95789833 CCCAACAGGCCGCTCAGACCAGG - Intergenic
934642441 2:96034748-96034770 CCCAACAGGCCGCTCAGACCAGG + Intronic
935187674 2:100748528-100748550 ACCAACAGGCTTCCCAGGCCAGG - Intergenic
936396591 2:112136642-112136664 CTCCACAGGCTGCCCTGGATCGG + Intergenic
936569032 2:113600128-113600150 GCCAACAGCTTGTCCAGGACAGG + Intergenic
937139829 2:119590504-119590526 CCAGACAGGCTGCCCAGAGCAGG - Intronic
937224515 2:120360462-120360484 CCCAAGAGGGTGCACAGGCCAGG + Intergenic
937335521 2:121059930-121059952 CCCATCAGCCTGCCAAGGCCAGG - Intergenic
937470241 2:122168284-122168306 TGCAACAGGCTGCTCAGGGCAGG + Intergenic
937833336 2:126446439-126446461 CCCAGGAGCCTGCACAGGACTGG + Intergenic
937910974 2:127075574-127075596 CCTGACAGGCTTCCCTGGACAGG - Intronic
938063111 2:128267385-128267407 GCCAACTGGCAGCCCAGGAGTGG - Exonic
938493992 2:131782483-131782505 CCCAACAGGGTGACCACTACTGG + Intergenic
942641548 2:178066490-178066512 TCCCACTGCCTGCCCAGGACTGG + Intronic
942749711 2:179274103-179274125 CTCAACAGGCTGCAGAGGCCAGG + Intergenic
946044545 2:216810434-216810456 CCCAACATGGGGCCCAGGAGCGG + Intergenic
946093195 2:217248754-217248776 CCCATCAGGCTGCGCAGATCAGG + Intergenic
948492490 2:238322063-238322085 CCCCACACACTGTCCAGGACAGG - Intronic
948909627 2:240996546-240996568 CCCAGCCAGCTGCCCAGGCCAGG - Intergenic
948912495 2:241011439-241011461 GCCAGCAGGCTGCCCAGCGCTGG - Intronic
1169980287 20:11377118-11377140 TCCAACAGGCTGGCCTGGGCTGG - Intergenic
1170738105 20:19028031-19028053 CCCAACAGGCAGCCCGGGTCGGG + Intergenic
1171101181 20:22385058-22385080 ACCAACAGACAGCACAGGACTGG + Intergenic
1171453030 20:25248829-25248851 CCCACAAGGCTGCCCAGGCCTGG - Intronic
1172032614 20:31992491-31992513 GCTCACACGCTGCCCAGGACAGG - Intronic
1172116571 20:32576730-32576752 CCCAGCAGCCCGCCCAGGCCAGG + Intronic
1172223426 20:33288836-33288858 TTCACCAGGCTGCCCAGCACAGG - Exonic
1173654482 20:44690217-44690239 CCAAACTGCCTCCCCAGGACAGG + Intergenic
1173744207 20:45424225-45424247 ACTACCAGCCTGCCCAGGACCGG + Exonic
1175501309 20:59453008-59453030 CCAGGCTGGCTGCCCAGGACTGG + Intergenic
1175807709 20:61839026-61839048 CCCAACAGGCTGCAAAGGCAAGG + Intronic
1176242720 20:64082580-64082602 CCCAGCAGGCTGCACAGAAGCGG - Intronic
1176299054 21:5090056-5090078 CCCAGAAGGCTGCCCTGGGCCGG + Intergenic
1178678288 21:34649439-34649461 CCCAACCCGCTGCCCATCACTGG + Intergenic
1178922479 21:36747770-36747792 CCCGCCAGGCCGCCCGGGACGGG + Exonic
1179477034 21:41653615-41653637 CCCAGCAGGCTGCCCAGGGAAGG + Intergenic
1179578099 21:42320246-42320268 CCCAGCTGTCGGCCCAGGACTGG - Intergenic
1179832545 21:44006415-44006437 CACAGCAAGCTGCCCAGAACCGG - Intergenic
1179857971 21:44171892-44171914 CCCAGAAGGCTGCCCTGGGCCGG - Intergenic
1182466366 22:30519355-30519377 CCCAACAGGGTGACCAGGGATGG - Intergenic
1182472568 22:30557454-30557476 CCCCCAAGGCTGCCCAGGCCTGG + Intronic
1182765221 22:32753479-32753501 CCCAACAGACTCCCCAGCAGGGG + Intronic
1183357485 22:37367427-37367449 CAGGACAGGCTGCCCAGGCCAGG + Intergenic
1183454703 22:37916140-37916162 CCCACCAGGCTGCCCAGAGAGGG - Intronic
1184268225 22:43361833-43361855 CCCAACAGCCTCTCCAGCACTGG - Intergenic
1184840058 22:47047401-47047423 CCCAGCACGCTGCCCTGCACAGG - Intronic
1185058972 22:48595657-48595679 CCCATCAGGCTGCAGGGGACGGG + Intronic
1185346154 22:50311736-50311758 CCCAACAGGCTGCCCAGGACAGG - Exonic
950787859 3:15450779-15450801 ACCAACAGCCTGCCCAGGTGTGG + Exonic
951252823 3:20414498-20414520 GACAACAAGCTACCCAGGACAGG - Intergenic
951848109 3:27106189-27106211 CCCAGCAGGCTGCCCACTAGGGG - Intergenic
954574476 3:51668193-51668215 CCCCCCAGCCTGCCCAAGACAGG + Exonic
954636565 3:52074118-52074140 CACAACAGGCAGCCCAGTGCTGG + Intergenic
954691308 3:52397055-52397077 CCCAAAGGGCTGCACAGGAGGGG + Intronic
955866152 3:63386743-63386765 CCCACCAGGCTGACCCGGGCTGG - Intronic
956142177 3:66156878-66156900 CCCAACAGGCTTCCATGGAAAGG + Intronic
961634038 3:128321726-128321748 CCCAGCAGGCAGCCCAGTGCTGG - Intronic
961653637 3:128429627-128429649 CCCACCCAGCTGCCGAGGACTGG + Intergenic
963283600 3:143411828-143411850 CCCAACAGGCAGACCTGTACAGG - Intronic
965680825 3:171249536-171249558 TCCTAAGGGCTGCCCAGGACTGG - Intronic
965747222 3:171938079-171938101 TCCACCAGGCTTCCCAGGGCAGG - Intronic
966924609 3:184636121-184636143 CCCAACAGGAGCCCCAGGAGAGG + Intronic
968068439 3:195771726-195771748 CCCAACAGGCTTCACAGGCCGGG - Exonic
968516180 4:1016565-1016587 CCCACCATGCTGCCCAGCCCTGG - Intronic
968554992 4:1242346-1242368 GACATCAGGCTGACCAGGACAGG + Intronic
968834236 4:2951313-2951335 CCCAGCCCGCTGCCCAGGGCAGG - Intronic
971350529 4:25851978-25852000 TCCCACAGGTTGCCCATGACTGG - Intronic
975008676 4:69322093-69322115 CCTAACAGGCAGGCAAGGACTGG - Intronic
985194476 4:187413620-187413642 TCCATGAGGCTGCCCAGGAGAGG - Intergenic
985575949 5:673582-673604 CCGACCAGGCTGCCCAGGACCGG + Intronic
985897658 5:2758698-2758720 CTCCACAGGATGCTCAGGACAGG - Intergenic
986407042 5:7436779-7436801 CCAAACAGGCTGCACACGCCTGG - Intronic
986438114 5:7755210-7755232 CCGCACAGGCTGCCCAGAGCTGG - Intronic
986638837 5:9851722-9851744 ACCAATATGCTGCCCAGTACTGG + Intergenic
986722075 5:10566499-10566521 ACCACCAGGCTGCCCAGGACAGG - Intronic
993921346 5:93807987-93808009 CACATCAGGCTGCCTTGGACAGG + Intronic
997366274 5:133327187-133327209 CCCTAGAGGAAGCCCAGGACAGG + Intronic
997453621 5:134002666-134002688 CTCAAAAGGATGTCCAGGACCGG + Intronic
998133830 5:139664362-139664384 CCCTGCAGGGTGCCCAGGAGAGG - Intronic
999742715 5:154568789-154568811 GCCAACAGGCTGCGGAGGAGTGG + Intergenic
1000120061 5:158188808-158188830 TGAAACAGGCTGCCCAGGAATGG - Intergenic
1001013388 5:168118560-168118582 CAAAACACGCAGCCCAGGACTGG - Intronic
1001317979 5:170657773-170657795 CCCACCAGGCTGCACAGCACTGG + Intronic
1002602516 5:180362067-180362089 CCCAACAGGAGGTCCAGGAAGGG + Intergenic
1006277265 6:33015351-33015373 CACAACAGTCTGCCCAGGGCAGG - Intergenic
1006357976 6:33571965-33571987 CAGACCAGGGTGCCCAGGACTGG + Intergenic
1006379843 6:33691123-33691145 CCCCACAACCTGCCCAGGAGAGG - Intronic
1007687647 6:43676517-43676539 CCCACCAGGCTGCCTGGGACAGG + Intronic
1011133492 6:84075250-84075272 CCCACCTGACTGCCCAGGGCTGG + Intronic
1014919443 6:127196048-127196070 CTCAACCAGATGCCCAGGACAGG + Exonic
1015654054 6:135497498-135497520 CCCGACACGCCGCCCAGGAGAGG + Intronic
1015836030 6:137421072-137421094 CCCAATTGTCTCCCCAGGACAGG - Intergenic
1017117961 6:150996650-150996672 CCCAGCCGGCTGCTCAGGCCTGG - Intronic
1018190553 6:161306081-161306103 TCCCACATCCTGCCCAGGACTGG + Intergenic
1018729858 6:166640554-166640576 CCCAGCAGGTTGCCCAGAACAGG - Intronic
1019162278 6:170076593-170076615 CCCAGCAGGGAGCCCAGGGCAGG - Intergenic
1019475534 7:1242403-1242425 CCCCACAGGCTGCGCCTGACGGG + Intergenic
1022111929 7:27237192-27237214 CCCAAGAGTCTGGCCAGGCCTGG - Intergenic
1022960062 7:35417933-35417955 CCCATCAGCCTGCCCAGCCCTGG - Intergenic
1022993007 7:35726712-35726734 CCCACCAGGCAGCACAGGGCAGG + Intergenic
1024282981 7:47734742-47734764 CCCACCAGTCTGGCCAGGACAGG + Intronic
1024556196 7:50605259-50605281 CCCTCCAGGCTGGCCAGGGCCGG + Intronic
1026379104 7:69781541-69781563 GCCAACAGGCTGCTGAGGGCAGG - Intronic
1026902627 7:74045417-74045439 AGCACCAGGCTGCCCAGGGCTGG - Intronic
1027190672 7:75994113-75994135 CCCGAGAGGCAGCCCAGGTCGGG - Intronic
1027452661 7:78350781-78350803 CCCATCAGTATGCACAGGACAGG + Intronic
1028739065 7:94251136-94251158 CCCAACAGATTGCCCATGATCGG + Intergenic
1032053641 7:128666836-128666858 CTCAACATGGTGCCCAGGCCAGG + Intergenic
1032803492 7:135335072-135335094 GCCAACAGGCAGCACAGCACTGG + Intergenic
1032837231 7:135685517-135685539 CTCACCAGGCTGCACAGGATGGG + Exonic
1033827124 7:145205376-145205398 CCCACCAGGCCTCCCAGGACAGG + Intergenic
1035035118 7:155889796-155889818 TGAAACAGGCTGCCCAGGGCTGG + Intergenic
1035203477 7:157280518-157280540 CCCTCAAGGCTGCCCAGGCCAGG + Intergenic
1035333740 7:158112788-158112810 CCCAGCAGGGTGCCCAGGCTGGG + Intronic
1036619473 8:10415188-10415210 CCCACCAGGCTGGACAGGGCTGG - Intronic
1036812909 8:11879992-11880014 TCCAACAGGCAGCCATGGACCGG - Intergenic
1042147549 8:65746127-65746149 CTCACCATGCTGCCCAGGGCTGG + Intronic
1042399096 8:68325575-68325597 CCCGACACTCTGCCTAGGACAGG - Intronic
1044016695 8:87054676-87054698 CCCAGCAGGCTGTCAGGGACTGG + Intronic
1046115762 8:109781475-109781497 CCCTGCAGGCTTCCCAGGAAAGG + Intergenic
1048982818 8:139712180-139712202 CCCAGCAGGCTTCCCAGTAGAGG + Intergenic
1049199022 8:141330955-141330977 CACCACAGGCTGCCCAGGTGGGG - Intergenic
1049232098 8:141489769-141489791 CCCAGGAGGTGGCCCAGGACAGG - Intergenic
1049377691 8:142296799-142296821 CCCCACAGGCTCCCCAGGACGGG + Intronic
1049598171 8:143494157-143494179 CCCCACAGGCTGACCACGCCTGG + Intronic
1049618013 8:143584602-143584624 GCCAACAGGGTGCTCAAGACAGG - Intronic
1049699528 8:144003508-144003530 TGCAACAGGCAGCACAGGACTGG + Intronic
1049883497 9:13402-13424 GCCAACAGCTTGTCCAGGACAGG - Intergenic
1056126472 9:83539608-83539630 CCCACCAGACTGTCCAGGGCAGG - Intergenic
1057209606 9:93192616-93192638 CCAGAGGGGCTGCCCAGGACAGG + Intronic
1060301995 9:122379537-122379559 ACCATGAGGCTGCACAGGACTGG - Intronic
1061667529 9:132169129-132169151 CCCACCTGTCTGCCCAGGAGAGG - Intronic
1061750817 9:132775787-132775809 CCCAAGAGGCAGCCGAGGATTGG - Intronic
1062036553 9:134385115-134385137 CACAACAGGCTGCCCTGCCCAGG - Intronic
1062379817 9:136281792-136281814 CCCAACAGTGTGCCCAGGGTGGG + Intronic
1185640374 X:1587469-1587491 CACACCAGGGTCCCCAGGACGGG - Intergenic
1190295512 X:49024803-49024825 TCCAACAGGCTGCAGAGAACCGG + Intergenic
1194436672 X:93875281-93875303 CCTGACAGGCTGTCAAGGACTGG + Intergenic
1200104637 X:153705546-153705568 CCCACCAGCCTGCCCCGCACTGG + Intronic
1200402319 X:156026747-156026769 GCCAACAGCTTGTCCAGGACAGG + Intergenic
1201762672 Y:17557478-17557500 CACAACAGGCCCCTCAGGACGGG - Intergenic
1201838880 Y:18348511-18348533 CACAACAGGCCCCTCAGGACGGG + Intergenic
1202060885 Y:20886784-20886806 CCCATCAGGCTACCAATGACTGG + Intergenic