ID: 1185348263

View in Genome Browser
Species Human (GRCh38)
Location 22:50320026-50320048
Sequence TGCAGGGCCCACTGGGAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185348263_1185348274 11 Left 1185348263 22:50320026-50320048 CCCCATTCCCAGTGGGCCCTGCA No data
Right 1185348274 22:50320060-50320082 GCTGCCTGAAGCCTGCCAGGAGG 0: 1
1: 0
2: 0
3: 41
4: 280
1185348263_1185348275 12 Left 1185348263 22:50320026-50320048 CCCCATTCCCAGTGGGCCCTGCA No data
Right 1185348275 22:50320061-50320083 CTGCCTGAAGCCTGCCAGGAGGG 0: 1
1: 0
2: 3
3: 44
4: 353
1185348263_1185348273 8 Left 1185348263 22:50320026-50320048 CCCCATTCCCAGTGGGCCCTGCA No data
Right 1185348273 22:50320057-50320079 TGGGCTGCCTGAAGCCTGCCAGG 0: 1
1: 0
2: 1
3: 32
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185348263 Original CRISPR TGCAGGGCCCACTGGGAATG GGG (reversed) Intronic
No off target data available for this crispr