ID: 1185348273

View in Genome Browser
Species Human (GRCh38)
Location 22:50320057-50320079
Sequence TGGGCTGCCTGAAGCCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 355}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185348267_1185348273 0 Left 1185348267 22:50320034-50320056 CCAGTGGGCCCTGCAATGTCTCC No data
Right 1185348273 22:50320057-50320079 TGGGCTGCCTGAAGCCTGCCAGG 0: 1
1: 0
2: 1
3: 32
4: 355
1185348262_1185348273 9 Left 1185348262 22:50320025-50320047 CCCCCATTCCCAGTGGGCCCTGC 0: 1
1: 0
2: 3
3: 31
4: 324
Right 1185348273 22:50320057-50320079 TGGGCTGCCTGAAGCCTGCCAGG 0: 1
1: 0
2: 1
3: 32
4: 355
1185348258_1185348273 16 Left 1185348258 22:50320018-50320040 CCCAGAGCCCCCATTCCCAGTGG 0: 1
1: 0
2: 1
3: 36
4: 256
Right 1185348273 22:50320057-50320079 TGGGCTGCCTGAAGCCTGCCAGG 0: 1
1: 0
2: 1
3: 32
4: 355
1185348265_1185348273 6 Left 1185348265 22:50320028-50320050 CCATTCCCAGTGGGCCCTGCAAT 0: 1
1: 0
2: 0
3: 14
4: 223
Right 1185348273 22:50320057-50320079 TGGGCTGCCTGAAGCCTGCCAGG 0: 1
1: 0
2: 1
3: 32
4: 355
1185348256_1185348273 30 Left 1185348256 22:50320004-50320026 CCCTCTAGGGAGCTCCCAGAGCC 0: 1
1: 0
2: 1
3: 13
4: 206
Right 1185348273 22:50320057-50320079 TGGGCTGCCTGAAGCCTGCCAGG 0: 1
1: 0
2: 1
3: 32
4: 355
1185348264_1185348273 7 Left 1185348264 22:50320027-50320049 CCCATTCCCAGTGGGCCCTGCAA 0: 1
1: 0
2: 0
3: 16
4: 229
Right 1185348273 22:50320057-50320079 TGGGCTGCCTGAAGCCTGCCAGG 0: 1
1: 0
2: 1
3: 32
4: 355
1185348270_1185348273 -8 Left 1185348270 22:50320042-50320064 CCCTGCAATGTCTCCTGGGCTGC 0: 1
1: 0
2: 3
3: 35
4: 277
Right 1185348273 22:50320057-50320079 TGGGCTGCCTGAAGCCTGCCAGG 0: 1
1: 0
2: 1
3: 32
4: 355
1185348257_1185348273 29 Left 1185348257 22:50320005-50320027 CCTCTAGGGAGCTCCCAGAGCCC 0: 1
1: 0
2: 2
3: 21
4: 229
Right 1185348273 22:50320057-50320079 TGGGCTGCCTGAAGCCTGCCAGG 0: 1
1: 0
2: 1
3: 32
4: 355
1185348260_1185348273 15 Left 1185348260 22:50320019-50320041 CCAGAGCCCCCATTCCCAGTGGG 0: 1
1: 0
2: 2
3: 33
4: 314
Right 1185348273 22:50320057-50320079 TGGGCTGCCTGAAGCCTGCCAGG 0: 1
1: 0
2: 1
3: 32
4: 355
1185348263_1185348273 8 Left 1185348263 22:50320026-50320048 CCCCATTCCCAGTGGGCCCTGCA No data
Right 1185348273 22:50320057-50320079 TGGGCTGCCTGAAGCCTGCCAGG 0: 1
1: 0
2: 1
3: 32
4: 355
1185348271_1185348273 -9 Left 1185348271 22:50320043-50320065 CCTGCAATGTCTCCTGGGCTGCC 0: 1
1: 0
2: 2
3: 18
4: 244
Right 1185348273 22:50320057-50320079 TGGGCTGCCTGAAGCCTGCCAGG 0: 1
1: 0
2: 1
3: 32
4: 355
1185348266_1185348273 1 Left 1185348266 22:50320033-50320055 CCCAGTGGGCCCTGCAATGTCTC 0: 1
1: 0
2: 1
3: 15
4: 157
Right 1185348273 22:50320057-50320079 TGGGCTGCCTGAAGCCTGCCAGG 0: 1
1: 0
2: 1
3: 32
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185348273 Original CRISPR TGGGCTGCCTGAAGCCTGCC AGG Intronic
900461801 1:2805314-2805336 TGCCCTGCCTGCAGGCTGCCAGG - Intergenic
900629871 1:3628693-3628715 AGGGCAGCATGAAGACTGCCAGG - Exonic
900899753 1:5508620-5508642 TGTCCTGCCTGAATCCTACCTGG + Intergenic
903931171 1:26863367-26863389 TGGGCGGCCAGAGGGCTGCCTGG + Exonic
904441564 1:30535157-30535179 TGGGCAGCCTGATGCCTGTCTGG + Intergenic
904484140 1:30813897-30813919 TGGGCTTCCTGGAGACAGCCTGG - Intergenic
905474669 1:38217705-38217727 TGGGGTCCCTGGAGCCTGCAGGG + Intergenic
905920549 1:41716091-41716113 TGTGCTCCCTGCACCCTGCCCGG - Intronic
907020397 1:51060886-51060908 TGAGCTGAGTGCAGCCTGCCAGG + Intergenic
908384728 1:63630264-63630286 TGGGCTCCCTGGGCCCTGCCAGG + Intronic
910399459 1:86824325-86824347 TGGTCTGGCTGTAGCCTGCTGGG - Intergenic
910654809 1:89609112-89609134 TGAGCTGAGTGCAGCCTGCCAGG - Intergenic
910812373 1:91251731-91251753 AGGGCTGCCTGATGCCTTCAGGG - Intergenic
910842346 1:91572411-91572433 TGGGCTGCCTCAACCCGCCCAGG + Intergenic
911098203 1:94073011-94073033 TGGGCTGCTGAAGGCCTGCCTGG - Intronic
911475295 1:98366422-98366444 TGAGCTGAGTGCAGCCTGCCAGG - Intergenic
917967443 1:180187465-180187487 TGGGGTGTCTGAGGCATGCCGGG - Intronic
919482625 1:198108319-198108341 AGGGCTGCCTGAAACCTTCGGGG + Intergenic
922503336 1:226112103-226112125 TTGGCTGCAGAAAGCCTGCCAGG + Intergenic
922799569 1:228359049-228359071 TGGCCTGCCTAAAGCCTTTCTGG + Intronic
922802076 1:228368982-228369004 TAGGCTGCCTGCTGCCTCCCCGG - Intronic
922827687 1:228533050-228533072 TGGAATGCCTGAAGTCGGCCAGG + Intergenic
924416268 1:243859862-243859884 TGGGAATCCTGAAGCCTGTCAGG - Intergenic
1062960777 10:1572361-1572383 ATAGCTGCCTGATGCCTGCCTGG - Intronic
1063545382 10:6976094-6976116 TGGGATGCCTGCATCCTGCCTGG - Intergenic
1063572211 10:7226192-7226214 TAGGCTGCTTGGAGCCTGCCTGG - Intronic
1065186667 10:23175170-23175192 TGGGCCTCCAGAGGCCTGCCAGG + Intergenic
1067018173 10:42772889-42772911 TGAGCTGAGTGCAGCCTGCCAGG + Intergenic
1067258507 10:44666146-44666168 TGAGCTGAGTGAAGCCTGCTGGG - Intergenic
1067414211 10:46091480-46091502 TGGGCTCCCTGGAGCCCTCCTGG + Intergenic
1067434262 10:46265995-46266017 TGGGCTCCCTGGAGCCCTCCTGG + Intergenic
1067800131 10:49353083-49353105 GGGGCTCCCTGAAGCATGGCTGG + Intergenic
1068385256 10:56317853-56317875 TGAGCTGACTTAAGCCTGCCAGG + Intergenic
1069830024 10:71277328-71277350 TGAGCTGCCTGAGGCCAGCAAGG + Intronic
1069983085 10:72265911-72265933 TGGGCTGCATGAAGTCTGGTAGG + Intergenic
1070321507 10:75358272-75358294 TGAGCTGCCTGGACCTTGCCCGG + Intergenic
1070373486 10:75807347-75807369 TGGGCAGCCTGAGGCCTGCCTGG + Intronic
1071393048 10:85194784-85194806 TGGGCTGGCTGTCCCCTGCCTGG + Intergenic
1071463487 10:85919959-85919981 CAGGCTGCCTGAACCCTGCTTGG + Intronic
1071956944 10:90770404-90770426 TGGGCTGCCTGCAGGCTCCATGG + Intronic
1076319123 10:129565095-129565117 GGCGCTGCGTGTAGCCTGCCCGG + Intronic
1076630319 10:131848445-131848467 TGAGCTGCCTGGGGCCTGGCGGG + Intergenic
1076733764 10:132450136-132450158 TGGGATGCCTCCAGTCTGCCAGG - Intergenic
1076832194 10:133001287-133001309 TGGGCTGCCTGCGTCCTGCTGGG + Intergenic
1077011518 11:381239-381261 AGGGCTGCCTCGAGCCTGCATGG - Intronic
1077046630 11:549600-549622 GGTGATGCCTGCAGCCTGCCAGG + Intronic
1077113191 11:870869-870891 AGGGCAGCCTGAGGCCTGTCTGG - Intronic
1077293955 11:1815359-1815381 TGGGCGGCCAGGAGCCTGCTGGG + Intergenic
1077353969 11:2106211-2106233 AGGGCTTCCTGATGCCTTCCTGG + Intergenic
1077377284 11:2211017-2211039 TGGGCTGCCTGGAACCTGGTTGG - Intergenic
1077962603 11:7090218-7090240 TGGGCACCCTGCAGCCTGACCGG - Exonic
1079472157 11:20789181-20789203 TGAGCTGAGTGCAGCCTGCCAGG - Intronic
1080110931 11:28566985-28567007 TGGGCTGCCTTCTGCCTGACAGG + Intergenic
1081283871 11:41245279-41245301 TGAACTGCGTGCAGCCTGCCAGG - Intronic
1081304757 11:41498195-41498217 TCTGCTGACTGCAGCCTGCCAGG + Intergenic
1081718614 11:45269125-45269147 TGGGCACCCTGAAGTCTGACAGG + Intronic
1081767232 11:45620214-45620236 TGAGCTGAGTGCAGCCTGCCAGG - Intergenic
1082173930 11:49040135-49040157 TTGGGTGCCTGAAGCCTAGCAGG + Intergenic
1084190694 11:67497422-67497444 GGGGCTGCCTGAAGGCTGTGGGG + Exonic
1084196126 11:67524278-67524300 TGGGCTGCCAGGGGCCTGGCTGG + Intergenic
1085031510 11:73273721-73273743 TGTTCTGCCAGAAGCTTGCCTGG + Intronic
1085339630 11:75722700-75722722 TGGGCTGGCTGAAGACACCCCGG - Intronic
1085777805 11:79382195-79382217 GTGGCTGGCTGAAGGCTGCCCGG - Intronic
1085784901 11:79440399-79440421 TGAGCTACCCGAACCCTGCCCGG + Intronic
1086700622 11:89896966-89896988 AGGGCTGCCCGGAGCATGCCAGG + Intergenic
1086705547 11:89947560-89947582 AGGGCTGCCCGGAGCATGCCAGG - Intergenic
1087418197 11:97885431-97885453 AGGGCAGACTGAAGGCTGCCTGG - Intergenic
1088533135 11:110832099-110832121 GGGGATGCCTCAGGCCTGCCAGG + Intergenic
1089633524 11:119797812-119797834 TGGGCTGCCATAAGCATACCTGG + Intergenic
1089785947 11:120907268-120907290 TGGGCTGCCTGATGACTGGTAGG + Intronic
1090194481 11:124802869-124802891 TGAGCTGAGTGCAGCCTGCCAGG - Intergenic
1090333325 11:125947558-125947580 TGGTCTTCCTGAACCCTGCCTGG + Intergenic
1091566426 12:1652065-1652087 TTGGCTGCCTGAACCCTGCAAGG - Intergenic
1091605474 12:1948140-1948162 TGGGGTGTCTGAAGTCTGTCTGG + Intronic
1092002545 12:5044213-5044235 TGGCCTGGCCGCAGCCTGCCCGG - Exonic
1092008342 12:5088206-5088228 TGGCCTGCCAGCAGCCTGCAGGG - Intergenic
1094018212 12:25885771-25885793 TGGGCTGAGTGCAGCCTGCCAGG + Intergenic
1094689384 12:32754276-32754298 TGGCCTGCCTAGAACCTGCCTGG - Intronic
1096222222 12:49838016-49838038 TGGGCTCTCTGAATCCTACCTGG - Exonic
1097104532 12:56613819-56613841 TGGTCTGCCTTAGGCCTACCTGG + Intronic
1099465474 12:82981445-82981467 ATGTCTGCCTGAAGCCAGCCTGG + Intronic
1102149515 12:110679141-110679163 TGGGGTGCCTTAAAGCTGCCAGG - Intronic
1102720642 12:115013310-115013332 TGGGCTCCAGGAAGCCAGCCAGG + Intergenic
1103005184 12:117415195-117415217 TGGGCTCGCTGCAGCCTACCAGG - Intronic
1103544013 12:121686983-121687005 TGCGCTTCCTGAAGCCAGACTGG + Intergenic
1103917852 12:124385223-124385245 TGGCCTGCCTCAAGCCCTCCAGG + Intronic
1103967928 12:124652094-124652116 CGGGCTGGCTCGAGCCTGCCAGG - Intergenic
1104747707 12:131220411-131220433 TGGGCTGAGTGAGTCCTGCCTGG + Intergenic
1104784700 12:131442006-131442028 TGGGCTGACTGAGTCCTGCGTGG - Intergenic
1104972526 12:132538412-132538434 AGGGCTGCCTGAGTCCTGCAAGG + Intronic
1105756359 13:23467509-23467531 AAGGCTTCGTGAAGCCTGCCGGG + Intergenic
1107464197 13:40634531-40634553 TGCCCTGCCTTAAGCCTCCCAGG - Intronic
1107720811 13:43246410-43246432 AGGCCTGCCTGGAGCCTGGCTGG - Intronic
1111237897 13:85432098-85432120 TGAGCTGAGTGCAGCCTGCCAGG + Intergenic
1112690952 13:101893291-101893313 TGAGCTGCATGAAGTCAGCCTGG + Intronic
1113039798 13:106092319-106092341 GGGGATGCATGAAGCCTGCGGGG - Intergenic
1113655698 13:112066962-112066984 TGGGCTGCCCGCTGCCTGCCCGG - Intergenic
1113657717 13:112079245-112079267 GGGGCTGCCTGTTCCCTGCCTGG - Intergenic
1113751218 13:112777727-112777749 AAGGCTGCCGGAAGGCTGCCAGG + Intronic
1113958451 13:114112251-114112273 GGGGCTGCCTGGAGCTGGCCTGG - Intronic
1114546978 14:23510227-23510249 TAGGCTGTCTGAAACCTGCAGGG - Intergenic
1114672078 14:24416769-24416791 TGGGCTGCCTCCAGCCTCACAGG - Exonic
1118438240 14:65790475-65790497 GGGCCTGGCTGATGCCTGCCTGG + Intergenic
1121541012 14:94726623-94726645 TTGGCTCCCAGAAGTCTGCCTGG - Intergenic
1121824518 14:96999671-96999693 TGAGCTGAGTGAAGCCTACCAGG - Intergenic
1122552435 14:102557227-102557249 TGGGGGGCCTGAAGGCTACCAGG - Intergenic
1123019933 14:105392934-105392956 TGGGCTGCCCGAGGCCAGCCCGG - Intronic
1124051553 15:26201373-26201395 TGGGCTGACGGGAGGCTGCCTGG - Intergenic
1125752496 15:42037942-42037964 TGAGCTGAGTGCAGCCTGCCAGG + Intronic
1127218374 15:56849274-56849296 TGGGCTGCATGCAGCCTGTGGGG - Intronic
1128726442 15:69991655-69991677 TGGGCTGCCTGGACCCTTCCGGG - Intergenic
1128751310 15:70152098-70152120 AGGCCTGCCTGAATCATGCCTGG + Intergenic
1128847999 15:70918269-70918291 TGAGCTGAGTGCAGCCTGCCAGG + Intronic
1129116373 15:73367622-73367644 GGCGCTGCATGAAGCCGGCCTGG + Exonic
1129376651 15:75137989-75138011 TGTGCTGCCTGGAGGCAGCCAGG - Intergenic
1129523650 15:76200925-76200947 TGTGCTGCCTCCAGCCTCCCAGG + Intronic
1129715258 15:77844426-77844448 TAGGTTTCCTGAGGCCTGCCAGG + Intergenic
1129761616 15:78131898-78131920 TGGGCTTCCCGAGGCCTGGCCGG - Intronic
1131522195 15:93125073-93125095 TGTGATGCCTGAAGCAGGCCAGG - Intergenic
1131541980 15:93282082-93282104 TGGGTTGCATGAAGGTTGCCAGG + Intergenic
1132513248 16:354113-354135 GGGGCTGCCTGGAGCATCCCGGG - Intergenic
1132574271 16:657437-657459 TGGGCTGCCTGCCGCCTCCTGGG - Intronic
1132615644 16:840104-840126 TGTGCTGCCTGAGCCCTGACAGG + Intergenic
1132626804 16:895151-895173 GGTGCGGCCTGAGGCCTGCCGGG + Intronic
1133008254 16:2896536-2896558 TGGGCTTCCTGGGGGCTGCCGGG - Exonic
1133013818 16:2929772-2929794 TGGGCTTCCTGGGGGCTGCCGGG - Exonic
1134056272 16:11171552-11171574 GGGGCTGGCTGAGGCCTGCCAGG - Intronic
1135402917 16:22178506-22178528 TGGGCTCCCTGAAGCCTGGATGG + Intronic
1137053474 16:35732105-35732127 TAGGCTGCCTGTGGTCTGCCTGG + Intergenic
1137447727 16:48542122-48542144 TGGGGAGCCTGCTGCCTGCCCGG + Exonic
1137615741 16:49845882-49845904 TGGGATGCCAGCAGCCTGCTGGG - Intronic
1138311551 16:56027975-56027997 TGAGCTGCTTAAAGCCTTCCTGG + Intergenic
1138451965 16:57098407-57098429 GGGGCTGCCTGTCGCCTGGCAGG + Intronic
1138488286 16:57360669-57360691 AGGGCTACCAGATGCCTGCCAGG + Intronic
1138878427 16:60980226-60980248 TGAGCTGCTCGTAGCCTGCCAGG + Intergenic
1139386945 16:66578990-66579012 AGGCCCGCCTGAAGCCAGCCCGG + Exonic
1139941787 16:70610823-70610845 GGGGCCCCCTCAAGCCTGCCGGG + Intronic
1140525019 16:75615587-75615609 TGGGCTGCATGTAGCCAGGCAGG + Intronic
1140922711 16:79553573-79553595 TGGTCTGGCTGAAGTCAGCCTGG + Intergenic
1142284813 16:89167403-89167425 TGGCCTCCCTGATCCCTGCCCGG + Intergenic
1142303708 16:89274131-89274153 TGGGCTGCTTGAAGGCAGACAGG + Intronic
1142406296 16:89892112-89892134 TTGGCTGCCTGATCCCTGCACGG - Intronic
1142903364 17:3026870-3026892 GGGGCTGCCTCAGGCCTGCGTGG + Intronic
1142959229 17:3542368-3542390 AGGGTTGCCTGAAGCATCCCTGG + Intronic
1143109032 17:4543310-4543332 AGGGCCGCCTGCAGGCTGCCTGG + Intronic
1146401469 17:32503305-32503327 AGGGCTGCCTGCAACCTCCCAGG - Intronic
1146543577 17:33718889-33718911 TGGGCTGCTGGTAGCATGCCTGG - Intronic
1146955518 17:36934688-36934710 TGCGCTGCGTGAGGCCTGCGGGG - Intergenic
1147140829 17:38459760-38459782 TGAGCTCCCTGCAGGCTGCCAGG - Intronic
1147718195 17:42522013-42522035 GGTTCTGCCTGCAGCCTGCCTGG + Exonic
1147898842 17:43770353-43770375 TGTGCTGTCAGAAGCCTGCAAGG + Intronic
1149095807 17:52839136-52839158 TGGGCTGCATCAAGCTTACCTGG - Intergenic
1149329998 17:55570668-55570690 TGAGCTGAGTGCAGCCTGCCAGG + Intergenic
1149603503 17:57908612-57908634 GGGGCTTCCTGAAACATGCCAGG + Intronic
1150229752 17:63543601-63543623 TTGGCTGCCAGGAGCCTGTCGGG - Exonic
1151787145 17:76280535-76280557 TGGGCTCTCAGAAACCTGCCTGG - Intronic
1152013395 17:77734679-77734701 TGGCCTGCCAGTGGCCTGCCTGG - Intergenic
1152356378 17:79809684-79809706 CGGGCGGCCTGGAGCCAGCCAGG - Intergenic
1152528781 17:80904665-80904687 GGGGCTGCCTGGGTCCTGCCCGG - Intronic
1152716963 17:81904878-81904900 TGGCCTTCCTGGAGGCTGCCAGG - Exonic
1155971978 18:32091977-32091999 TGCGCTGCCTACAGCCTACCCGG - Exonic
1156812677 18:41271861-41271883 TGAGCTTCCTGAGGCCTCCCTGG + Intergenic
1157381554 18:47222735-47222757 GGGGCTGCCTGAAGCCGACCAGG + Intronic
1158580193 18:58674085-58674107 TGGGCTTCCTGAAGAAAGCCAGG + Intronic
1160016293 18:75143277-75143299 TGAGCTACCTGAAGCCTCCTGGG + Intergenic
1160312910 18:77812658-77812680 TGGGCTGCATGGTGCCTGTCTGG - Intergenic
1161428611 19:4217818-4217840 TGAGCTGCCTGCGGCCTGCGAGG + Exonic
1162244612 19:9389521-9389543 TGGGCTGCCTGAGGCCTTGGGGG - Intergenic
1163439013 19:17312244-17312266 AGGGCTGACTGAACCCTGGCCGG - Intronic
1163513934 19:17751697-17751719 TGGGCTGGCCAAAGCCTGCATGG + Intronic
1163633608 19:18428795-18428817 TGGGCAGGCTGAAGCCCTCCTGG + Intronic
1163699803 19:18781479-18781501 TGGGGTGCCTGACCCCTGCCTGG - Exonic
1164372200 19:27652540-27652562 TGGGCTGCCTGGGGTCGGCCAGG + Intergenic
1164379327 19:27718702-27718724 TAGACTGCCTGAAGTCAGCCAGG + Intergenic
1164386035 19:27771249-27771271 TAGACTGCCTGGGGCCTGCCAGG + Intergenic
1164433328 19:28207405-28207427 GGGGGTGGCTGAAGCCTCCCTGG - Intergenic
1164455569 19:28403953-28403975 TGGGCTGCCTCCTGCCTGGCTGG + Intergenic
1164527740 19:29024176-29024198 TGGGCTCCCTGAAGCCCACATGG + Intergenic
1164649159 19:29879630-29879652 TGGGAGACCTGCAGCCTGCCTGG + Intergenic
1164685999 19:30167284-30167306 TGGGCAGGCTGGAGCCTGCCTGG + Intergenic
1166462675 19:43003100-43003122 TGGCCTGCCTGGACCCTGACTGG - Intronic
1166468812 19:43059557-43059579 TGGCCTGCCTGGACCCTGACTGG - Intronic
1166479957 19:43163078-43163100 TGGCCTGCCTGGACCCTGACTGG - Intronic
1166489783 19:43248609-43248631 TGGCCTGCCTGGACCCTGACTGG - Intronic
1166570982 19:43797297-43797319 TGGGGTGCCTGGTGCCTGGCTGG + Exonic
1167490450 19:49789978-49790000 TGGGCTGCCCGCTGGCTGCCAGG + Intronic
1167611628 19:50510589-50510611 TGTGCTGCCAGGAGACTGCCAGG - Intronic
1168316823 19:55488259-55488281 TTTGCTGGCTGGAGCCTGCCTGG + Intergenic
1168408929 19:56126434-56126456 TGGGCATCCTGGAGTCTGCCTGG - Intergenic
1168644199 19:58049617-58049639 GGGGCTGCCTGAAGCCTGTAAGG + Intronic
925033051 2:666273-666295 TTGGCTGCCTGAAGGCTGCAGGG + Intergenic
925924498 2:8660353-8660375 TGGGCTGGCTGGACCCTGACAGG + Intergenic
926161237 2:10491093-10491115 TGGGTTACCTGAGGCCTGCATGG + Intergenic
926743114 2:16128349-16128371 TTGGCTTCCTGCAGCATGCCAGG + Intergenic
927155765 2:20220271-20220293 GGGGCTGGCTGAACCCTGCAAGG - Intronic
927853352 2:26513444-26513466 TGGGCTGCCCGGGGCCTGTCTGG + Intronic
929571712 2:43026955-43026977 TGGGGGGCCTGAAGCCAGCAGGG - Intergenic
929604515 2:43226011-43226033 TGGGCGGCGCGAAGCCTGTCCGG + Intronic
930516373 2:52412453-52412475 TAGACTACCTGAAGCCAGCCAGG + Intergenic
930946512 2:57083428-57083450 AGAGCTGACTGTAGCCTGCCAGG - Intergenic
932212363 2:69943283-69943305 TGAGCAGCCTGTAGCCTGCTGGG + Intergenic
932594024 2:73083203-73083225 TGAGCTGTCTGGAGCTTGCCCGG + Intronic
934608817 2:95719684-95719706 TGGGCTGCCTGGCGCCACCCTGG + Intergenic
934696384 2:96403654-96403676 TGAGCTGAGTGCAGCCTGCCAGG - Intergenic
935700977 2:105811621-105811643 TGGGTTGCATGAAGGATGCCAGG + Intronic
936108810 2:109648261-109648283 TTGGCTGGCTGCAGCCTGGCAGG + Intergenic
936501796 2:113072532-113072554 AGAGCTGCCTGGAGCCTGCTGGG + Exonic
936542111 2:113361151-113361173 TGGGCTGCCTGGCGCCACCCTGG + Intergenic
937252825 2:120534993-120535015 TGCACTGCCTTAAGCCTGCCTGG - Intergenic
942148012 2:173044945-173044967 TGGCCTGCCTGGAGCTGGCCAGG - Intronic
943928365 2:193818834-193818856 TGAGCTGAGTGCAGCCTGCCAGG - Intergenic
944931311 2:204522854-204522876 TGGGCTGCCTGAGGACTGAAAGG - Intergenic
945072215 2:206003473-206003495 TGGGATGACTGCAGGCTGCCGGG - Exonic
947571017 2:231234449-231234471 TGGGCTGCTTGACTCCTGCTAGG - Intronic
947711613 2:232319611-232319633 GGGGAGGCCTGAAGGCTGCCTGG + Intronic
948534996 2:238639045-238639067 TGCTCTGCCTGAAGGCTCCCGGG - Intergenic
1170614790 20:17939820-17939842 TGGGCTGCCTTAAGGCATCCAGG - Intergenic
1172245427 20:33442767-33442789 AGGGCTCCCTGCAGCCTTCCTGG + Intronic
1173624944 20:44465860-44465882 GGGGCAGCTTGAAGCCAGCCAGG - Intergenic
1173721146 20:45259168-45259190 TGGAGTGCCTGAAGCCAGCCAGG - Intergenic
1176973125 21:15289291-15289313 TGAGCTGAGTGCAGCCTGCCAGG - Intergenic
1178947513 21:36960229-36960251 TGAGCTGAGTGCAGCCTGCCAGG + Intronic
1179841688 21:44080104-44080126 TGGGCTGTCTGACGGCTGGCTGG - Exonic
1180176501 21:46093033-46093055 AGGGCAGCCTGCAGCCTGCTGGG + Intergenic
1180180345 21:46116104-46116126 TGGGCTGGGGGGAGCCTGCCTGG - Intronic
1180915564 22:19484061-19484083 AGGTCATCCTGAAGCCTGCCAGG + Intronic
1181011612 22:20044148-20044170 TGGGCACCCTGGAGCATGCCAGG - Intronic
1182147821 22:28007682-28007704 TGACCTGCCTGGAACCTGCCAGG + Intronic
1182485644 22:30636967-30636989 GGGGCCGCCTGCAGCCTGGCTGG + Exonic
1182577175 22:31280868-31280890 TGGGCTGCCTGCAGCAGCCCTGG - Intergenic
1183495713 22:38142692-38142714 TGGGCTGCATGCAGCCTGCAGGG + Intronic
1184046458 22:41975522-41975544 TGGGCAGCCAGCAGCCTGCTAGG + Intergenic
1184074639 22:42168571-42168593 CGGGCTCCCTGCATCCTGCCCGG - Intronic
1184655901 22:45941962-45941984 TGGGGTCCCTGAGGCCTGGCTGG + Intronic
1184804832 22:46787886-46787908 TAAGCTGGCTGCAGCCTGCCAGG + Intronic
1184900144 22:47441276-47441298 TCGGCTGACTGCAGCCTCCCAGG - Intergenic
1184912881 22:47547934-47547956 CTGGCTGCCTAAAGCCTCCCGGG + Intergenic
1185049006 22:48543980-48544002 TGGGCTGCCTGGAGCCCCCCAGG - Intronic
1185348273 22:50320057-50320079 TGGGCTGCCTGAAGCCTGCCAGG + Intronic
949569206 3:5275625-5275647 TGGGCTGACCCAGGCCTGCCTGG - Intergenic
950039622 3:9911529-9911551 AGTGCTGCCTGGAGCCTCCCAGG + Exonic
950196877 3:11015570-11015592 AGGGGTGCAGGAAGCCTGCCAGG - Intronic
950639275 3:14337891-14337913 TGTGATATCTGAAGCCTGCCCGG - Intergenic
951718321 3:25672983-25673005 TGAGCTGGGTGCAGCCTGCCAGG - Intergenic
952034314 3:29180915-29180937 TGGGCTCTCTGAAGCCTGGTTGG + Intergenic
952972997 3:38666695-38666717 TAAGCTTCCTGAAGCCTCCCTGG + Intergenic
953033400 3:39192088-39192110 GGGCCTGCCTGAAGCTTCCCTGG + Intronic
953360108 3:42288516-42288538 TGGGCTCCCCGAAGCCTACCTGG + Intergenic
953461067 3:43081487-43081509 AGGGATGGGTGAAGCCTGCCTGG - Exonic
953603189 3:44387702-44387724 TGAGCTGAGTGCAGCCTGCCAGG + Intronic
953810673 3:46109719-46109741 TGGGCAGCAAGAAGCCTGCTGGG - Intergenic
954305587 3:49723762-49723784 TGAGGTGCCTGCAGCCCGCCTGG + Exonic
954708847 3:52495178-52495200 TGGGCGGCCTGAGCCCTGCTCGG - Intergenic
954790703 3:53131202-53131224 TGGGCTTCCTACAGCCTGCTTGG - Intergenic
956468733 3:69542933-69542955 TGGGATGCCTGAAGCCGGTGAGG - Intergenic
956814392 3:72894726-72894748 TGGGTTGCATGAAGATTGCCAGG + Intronic
957362409 3:79176113-79176135 CTGGCTGCCTGAAGTCTTCCAGG + Intronic
957618745 3:82567481-82567503 TGAGCTGAGTGAAGCATGCCAGG + Intergenic
957996254 3:87693200-87693222 TGGATTGCCTGAGGCCAGCCTGG - Intergenic
958650580 3:96931479-96931501 TGGGGTGGCTGAAGCCTGGCTGG + Intronic
961053339 3:123766325-123766347 TGGGCGGCCTGGAGCCTGTGTGG - Intronic
961522029 3:127472572-127472594 TTGTCTGGCTGGAGCCTGCCGGG + Intergenic
963178198 3:142323752-142323774 AGGACTGCTTGAAGCCAGCCTGG + Intronic
964073841 3:152668755-152668777 TGGCCTCCCAGAACCCTGCCGGG + Intergenic
964328082 3:155569603-155569625 TGAGCTGCTCAAAGCCTGCCTGG - Intronic
965813241 3:172613351-172613373 TGAGCTGAATGCAGCCTGCCAGG - Intergenic
966130878 3:176637522-176637544 TGGGCTGCATGTAGCCTGTTGGG - Intergenic
966815680 3:183887897-183887919 GTGGCTCCCTGAAGGCTGCCTGG - Intergenic
966939596 3:184737190-184737212 TGAGCTGCCAGCAGGCTGCCTGG + Intergenic
967859664 3:194141505-194141527 TGTGCAGCCGGCAGCCTGCCAGG + Intergenic
968598183 4:1496043-1496065 TGGGCTGCGTGAGGTCTTCCAGG + Intergenic
968688427 4:1976917-1976939 TGGGCTGCCTGAATCCCTCCTGG - Intronic
968828150 4:2914800-2914822 CGCCCTGCCTGCAGCCTGCCTGG + Intronic
969254233 4:5991649-5991671 AGAACTGCCTGCAGCCTGCCAGG - Intergenic
969546754 4:7835035-7835057 TGGGCTGCCTTAAGGTTACCTGG + Intronic
969546810 4:7835287-7835309 TGGGCTGCCTTAAGGTTACCTGG + Intronic
969546845 4:7835455-7835477 TGGGCTGCCTTAAGGTTACCTGG + Intronic
970615793 4:17767145-17767167 TGGGCTGCCTGCAGCCCTCGCGG - Intronic
973041296 4:45472769-45472791 TGAGCTGAGTGTAGCCTGCCAGG + Intergenic
973257867 4:48130907-48130929 TGGTGTGCCTGAAGCATGCCTGG - Intronic
973813101 4:54592262-54592284 TGGACTCCCTGAAGCCTACCAGG + Intergenic
975254218 4:72215319-72215341 GGAGCTGACTGCAGCCTGCCAGG - Intergenic
975459406 4:74632968-74632990 TGGGCTTGATGAAGCCTGCTGGG - Intergenic
977651349 4:99473168-99473190 AGGGCTGCCTGAAGCCTTTGGGG - Intergenic
977817214 4:101428928-101428950 TGGGCTTTCTGCAGCCTGACAGG + Intronic
978037521 4:104013996-104014018 TGGGCTGCATGTAGTCTGCAAGG + Intergenic
980259665 4:130432409-130432431 AGGGCTCCCTCAACCCTGCCAGG + Intergenic
980770172 4:137361769-137361791 CAGGCTGCCCGAAGCCTACCTGG - Intergenic
983969211 4:173850462-173850484 AGCGATGCCTGAAGCCTCCCTGG + Intergenic
984713424 4:182904552-182904574 TGCGCTGCCTGAGGCAGGCCAGG - Intronic
987054622 5:14179576-14179598 TGGGCTTCGTGATGCATGCCTGG - Intronic
988492057 5:31713256-31713278 GCGACTGCCTGCAGCCTGCCTGG + Intronic
990651915 5:57909916-57909938 GGGGCTGCCTGCAGCCTTCTTGG + Intergenic
991200767 5:63988802-63988824 TGTGCTGCATGCAGCCTGCAGGG - Intergenic
992633081 5:78700525-78700547 TGGCCCACTTGAAGCCTGCCAGG - Intronic
993310976 5:86331471-86331493 GGGGCTGCCTGAAGCCTTGGTGG + Intergenic
993620372 5:90161242-90161264 TGGGCAGGCTGCAGCCTGGCAGG - Intergenic
995146149 5:108788396-108788418 TGAGCTGAGTGCAGCCTGCCAGG + Intronic
995863107 5:116662009-116662031 TGAGCTGAGTGCAGCCTGCCAGG + Intergenic
997255774 5:132426938-132426960 TGGGCTGCCTGGAGCCCGGGTGG + Intronic
997396177 5:133561670-133561692 TGTGCTGGCTGAAGCCTGAAAGG - Intronic
997657889 5:135568804-135568826 TGGGAGCCCTGAACCCTGCCTGG - Intergenic
997712672 5:136018988-136019010 TGGGCAACATGCAGCCTGCCTGG + Intergenic
998151628 5:139760659-139760681 TAGGGTGCCAGGAGCCTGCCTGG - Intergenic
1000423582 5:161064459-161064481 TGGGCTACCTGCAGCCTGAGGGG + Intergenic
1001449814 5:171815965-171815987 TGGGCTCTCTGAGGTCTGCCTGG - Intergenic
1001848450 5:174941865-174941887 TGGGCTGCCTGAAGAAAGGCTGG + Intergenic
1002169524 5:177367343-177367365 TGGGCTGCCTGCACCCAGGCCGG - Intronic
1002908791 6:1472219-1472241 TGGGCTGGCTGAAGCCCCCAGGG + Intergenic
1003490177 6:6614454-6614476 TGGGCTGCCTGCAGGCTCGCGGG - Intronic
1004730203 6:18350375-18350397 TGGACTGCTTGAAACCAGCCTGG + Intergenic
1006182910 6:32164622-32164644 TGGTCTGCTTGAAGCCTCCCAGG + Exonic
1006184559 6:32173751-32173773 AGGGCTGCCTGAACCCCTCCAGG + Intronic
1006503395 6:34472718-34472740 TGTGGTGCCTGAAACCTGGCGGG + Intronic
1006826136 6:36937689-36937711 TGGGATGCCTGGAGACTGGCAGG - Intergenic
1007417928 6:41702922-41702944 TAGGCTCCCTGCCGCCTGCCTGG + Intronic
1007686213 6:43668748-43668770 AGGGCAGCTTGCAGCCTGCCTGG - Intronic
1008763512 6:54882555-54882577 TGGTTTGCATGGAGCCTGCCTGG - Intronic
1009954266 6:70433435-70433457 TGGTTTGCCTGAAGCCATCCTGG - Intronic
1011208088 6:84923214-84923236 GGGGCTGCCAGCAGCCAGCCAGG - Intergenic
1015576314 6:134675285-134675307 TGTTCTGCCTGATGCCTGGCAGG - Intergenic
1018188237 6:161286564-161286586 TGGGTTCCCTGAAGAATGCCAGG - Intergenic
1018337830 6:162814556-162814578 TGGACTGCCTGAAACAGGCCGGG - Intronic
1018901720 6:168054911-168054933 TGGGCTTCATGTGGCCTGCCTGG + Intergenic
1018945265 6:168343499-168343521 TGGGCTCCCTGTACCCTTCCTGG - Intergenic
1019814403 7:3189163-3189185 TGCGCTCCCTGCAGCCTCCCTGG - Intergenic
1023672336 7:42590852-42590874 TGGCCTGTCTGAGGCCTGGCCGG + Intergenic
1023681291 7:42690554-42690576 GGGACTTCCTGCAGCCTGCCTGG + Intergenic
1024208257 7:47182124-47182146 TGAGCTGCTTCCAGCCTGCCAGG + Intergenic
1024973678 7:55093827-55093849 GTGGCTGCCTGAATCATGCCTGG + Intronic
1028035004 7:85971635-85971657 TGAGCTGAATGCAGCCTGCCAGG - Intergenic
1029124704 7:98288004-98288026 TGGGCTGGCTGAGGGGTGCCCGG + Intronic
1029938471 7:104453890-104453912 TAAGCTTCCTGAAGCCTCCCTGG + Intronic
1030130748 7:106197635-106197657 TGCACTGCCTGAAGCCTACCTGG - Intergenic
1031971404 7:128067578-128067600 TGGGCTGCCTCAAGCAGGACAGG - Intronic
1032704970 7:134413770-134413792 TGGACAGCCTGCAGCCTACCAGG + Intergenic
1033138532 7:138804446-138804468 TGATCTGCCTGGAGCCTTCCTGG + Exonic
1034696530 7:153059052-153059074 TAGGCTTCCTAAAACCTGCCTGG - Intergenic
1035488557 7:159252119-159252141 TGGGTTTCCTGCAGCCTACCTGG + Intergenic
1035569879 8:665505-665527 TGGGCGGGATGGAGCCTGCCTGG - Intronic
1035780910 8:2227842-2227864 AGGGTAGCCTGGAGCCTGCCTGG - Intergenic
1037060112 8:14497450-14497472 TGGGCTGCATTCAGCCTGCAGGG - Intronic
1037060781 8:14506807-14506829 TGGGCTGCCTGAAGTCAAACAGG - Intronic
1038278907 8:26145250-26145272 TGCTCTGCCTGAAGACTGCATGG - Intergenic
1040316135 8:46261880-46261902 TGGGTTGGCAGAGGCCTGCCTGG - Intergenic
1041491950 8:58443002-58443024 TGAGCTGACTGAAGCCTGACTGG + Intronic
1043615005 8:82114611-82114633 GGGGCTGCCTGAAGCCTTGGTGG - Intergenic
1044412962 8:91904458-91904480 TTGGCTTACTGAAGCTTGCCAGG + Intergenic
1046758235 8:117993368-117993390 TGGCCTGGCTGTATCCTGCCGGG - Intronic
1047093093 8:121594949-121594971 TGGGATGCGTGAAGGTTGCCAGG - Intergenic
1047263044 8:123279481-123279503 TGGGCTGTCTGGGGGCTGCCTGG + Intergenic
1048463576 8:134642977-134642999 TGGGATGCCTTCAGCCTCCCTGG - Intronic
1048568057 8:135624634-135624656 AGGGCTGCTTGAAGCCTCACAGG - Intronic
1048777008 8:137958143-137958165 TGGCCTGCCTTAAGCCAGCTAGG + Intergenic
1048981507 8:139705255-139705277 TCGGCTTCCTGAATCCCGCCTGG + Intergenic
1049127452 8:140804823-140804845 AGGGCTGCCTGTGGCCTCCCGGG - Intronic
1049578067 8:143398657-143398679 TGGGCTGCCTGGAGCCTAGCTGG - Intergenic
1049735345 8:144202217-144202239 TGGGCTGTCTGGAGGCTGGCGGG + Intronic
1049787407 8:144457588-144457610 TGAGCTGCCTGTAGCCAGCAGGG - Intronic
1050725641 9:8644870-8644892 TGAGCTGAGTGCAGCCTGCCAGG + Intronic
1052648857 9:31273587-31273609 AGGGCTGCCTGAAGCCTTAGTGG + Intergenic
1052825636 9:33172206-33172228 TGGGCTGGCTCAAGTCTCCCTGG + Intergenic
1054462433 9:65472553-65472575 TGGGCAGCCAGAAGCTTACCTGG - Intergenic
1056660683 9:88540779-88540801 GGGGCTGCATGACCCCTGCCAGG - Intronic
1059061381 9:111038206-111038228 CGCGCGGCCTGAAGCCAGCCCGG - Intronic
1060102857 9:120856012-120856034 TGGGCTCTCTGAAGCCAGGCAGG + Exonic
1060300377 9:122371421-122371443 GGGGCTCCCTGAAGCCCCCCCGG + Intronic
1060543637 9:124448123-124448145 TGGGGAGCCTGAGGTCTGCCAGG - Intergenic
1060828640 9:126700456-126700478 AGGATTGCCTGATGCCTGCCTGG + Exonic
1060990319 9:127845248-127845270 TGGGCTGTCTGGAGCCTCACCGG + Intronic
1061014464 9:127973834-127973856 TGTGCTGCCTTAGGCCAGCCTGG - Intronic
1061398456 9:130355818-130355840 TGGGGAGCCTGAGGCCTGGCAGG - Intronic
1061841162 9:133359325-133359347 TGGGCTGCATGAGCCCTGCTGGG - Intronic
1061847066 9:133393802-133393824 GGGGCTGCCTGAAGCCAACCAGG + Intronic
1062543519 9:137051914-137051936 TTGGCCTCCTGAGGCCTGCCTGG + Intronic
1189848514 X:45157649-45157671 TGGACTCCCAGAAGCCTCCCTGG - Intronic
1191229384 X:58082094-58082116 TGGAGTGCCAGAAGTCTGCCAGG - Intergenic
1191229557 X:58083364-58083386 TAGGATGCCTGAAGTCAGCCAGG + Intergenic
1192693695 X:73391809-73391831 TTGGCTGCCTGAAATCTTCCAGG + Intergenic
1193574895 X:83185125-83185147 TGAGCTGGGTGCAGCCTGCCAGG - Intergenic
1194219585 X:91175006-91175028 TGGCCTGCCAGAATCCTTCCTGG - Intergenic
1195998537 X:110756573-110756595 TGGGCTGCCTCATGCCTGAATGG - Intronic
1196389528 X:115192564-115192586 TGGGCACCCTGCAGCCTGACCGG - Exonic
1197614809 X:128679322-128679344 TGGGTTGAATGAAGCTTGCCAGG - Intergenic
1198223993 X:134628742-134628764 TGGGTTCCCTGAATTCTGCCTGG + Intronic
1199772818 X:150984668-150984690 CGGGCTGCCTGCTGCCGGCCGGG + Intronic
1200236577 X:154470626-154470648 TGGGCTGCCAGCAGCCTGTCTGG + Intronic
1200239866 X:154487788-154487810 TGGGTAGCCGGATGCCTGCCAGG + Exonic
1200556098 Y:4638770-4638792 TGGCCTGCCAGAATCCTTCCTGG - Intergenic