ID: 1185348274

View in Genome Browser
Species Human (GRCh38)
Location 22:50320060-50320082
Sequence GCTGCCTGAAGCCTGCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 0, 3: 41, 4: 280}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185348271_1185348274 -6 Left 1185348271 22:50320043-50320065 CCTGCAATGTCTCCTGGGCTGCC 0: 1
1: 0
2: 2
3: 18
4: 244
Right 1185348274 22:50320060-50320082 GCTGCCTGAAGCCTGCCAGGAGG 0: 1
1: 0
2: 0
3: 41
4: 280
1185348258_1185348274 19 Left 1185348258 22:50320018-50320040 CCCAGAGCCCCCATTCCCAGTGG 0: 1
1: 0
2: 1
3: 36
4: 256
Right 1185348274 22:50320060-50320082 GCTGCCTGAAGCCTGCCAGGAGG 0: 1
1: 0
2: 0
3: 41
4: 280
1185348262_1185348274 12 Left 1185348262 22:50320025-50320047 CCCCCATTCCCAGTGGGCCCTGC 0: 1
1: 0
2: 3
3: 31
4: 324
Right 1185348274 22:50320060-50320082 GCTGCCTGAAGCCTGCCAGGAGG 0: 1
1: 0
2: 0
3: 41
4: 280
1185348260_1185348274 18 Left 1185348260 22:50320019-50320041 CCAGAGCCCCCATTCCCAGTGGG 0: 1
1: 0
2: 2
3: 33
4: 314
Right 1185348274 22:50320060-50320082 GCTGCCTGAAGCCTGCCAGGAGG 0: 1
1: 0
2: 0
3: 41
4: 280
1185348263_1185348274 11 Left 1185348263 22:50320026-50320048 CCCCATTCCCAGTGGGCCCTGCA No data
Right 1185348274 22:50320060-50320082 GCTGCCTGAAGCCTGCCAGGAGG 0: 1
1: 0
2: 0
3: 41
4: 280
1185348270_1185348274 -5 Left 1185348270 22:50320042-50320064 CCCTGCAATGTCTCCTGGGCTGC 0: 1
1: 0
2: 3
3: 35
4: 277
Right 1185348274 22:50320060-50320082 GCTGCCTGAAGCCTGCCAGGAGG 0: 1
1: 0
2: 0
3: 41
4: 280
1185348267_1185348274 3 Left 1185348267 22:50320034-50320056 CCAGTGGGCCCTGCAATGTCTCC No data
Right 1185348274 22:50320060-50320082 GCTGCCTGAAGCCTGCCAGGAGG 0: 1
1: 0
2: 0
3: 41
4: 280
1185348266_1185348274 4 Left 1185348266 22:50320033-50320055 CCCAGTGGGCCCTGCAATGTCTC 0: 1
1: 0
2: 1
3: 15
4: 157
Right 1185348274 22:50320060-50320082 GCTGCCTGAAGCCTGCCAGGAGG 0: 1
1: 0
2: 0
3: 41
4: 280
1185348264_1185348274 10 Left 1185348264 22:50320027-50320049 CCCATTCCCAGTGGGCCCTGCAA 0: 1
1: 0
2: 0
3: 16
4: 229
Right 1185348274 22:50320060-50320082 GCTGCCTGAAGCCTGCCAGGAGG 0: 1
1: 0
2: 0
3: 41
4: 280
1185348265_1185348274 9 Left 1185348265 22:50320028-50320050 CCATTCCCAGTGGGCCCTGCAAT 0: 1
1: 0
2: 0
3: 14
4: 223
Right 1185348274 22:50320060-50320082 GCTGCCTGAAGCCTGCCAGGAGG 0: 1
1: 0
2: 0
3: 41
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185348274 Original CRISPR GCTGCCTGAAGCCTGCCAGG AGG Intronic
900291543 1:1925737-1925759 GCTGGCTCCAGCCTCCCAGGAGG - Intronic
900494750 1:2971351-2971373 GAGGCCTGAATCCTGGCAGGAGG + Intergenic
900614093 1:3556651-3556673 GCTGCCTGCAGTCTGCTTGGTGG - Intronic
900808843 1:4785874-4785896 GGTGCCAGGAGGCTGCCAGGGGG - Exonic
901163074 1:7195211-7195233 GCTGCCATATGCCTGCAAGGTGG - Intronic
901529747 1:9845464-9845486 TCTGTCTGAAGCCTCCCATGCGG - Intergenic
902131040 1:14260660-14260682 GCAGCCTGGTGCCTGCCAGCCGG - Intergenic
903337352 1:22634109-22634131 GCTGAGTGCTGCCTGCCAGGAGG - Intergenic
903589297 1:24442069-24442091 GATCCTTGGAGCCTGCCAGGCGG - Exonic
904277253 1:29392556-29392578 GCAGCCTGAAGCTGGGCAGGGGG - Intergenic
904290980 1:29485717-29485739 GATGCCTGACCCCAGCCAGGAGG - Intergenic
905691591 1:39947220-39947242 GCTACCTGAAGAGTGCAAGGAGG - Intergenic
906718548 1:47988552-47988574 CCTGTCTGAAGCCTGGCAGCAGG + Intronic
907298310 1:53469688-53469710 GCTGCTGGAGGCCTGCCTGGAGG - Intergenic
908458826 1:64329790-64329812 AGTGCCTGAAGCTTTCCAGGTGG - Intergenic
913189728 1:116403284-116403306 GCTGCCTGGAGCCTGTCAGCAGG + Intronic
917736512 1:177926050-177926072 GCAACCTGAAGCCTGCGAGAGGG + Intronic
918523022 1:185435865-185435887 GGTGTCTGAAGCCTGGCAGCAGG + Intergenic
920205684 1:204289476-204289498 CCTGCTTTAAACCTGCCAGGGGG + Intronic
921049974 1:211504321-211504343 ACAGCCAGAAGCCTGCCTGGGGG - Intergenic
922793207 1:228322033-228322055 GCTCACTGAGGCCCGCCAGGCGG + Exonic
923423875 1:233848490-233848512 GGTGCCTGATGACTGCCAAGTGG - Intergenic
1062791082 10:307111-307133 GCTCCCTGAAGCCTGACCAGAGG + Intronic
1063050799 10:2444952-2444974 GCTGCGTGAAGCCCGCCGTGTGG + Intergenic
1063339771 10:5252363-5252385 TCTGCCCGCAGCCTTCCAGGTGG + Intergenic
1063412152 10:5844782-5844804 GCAGCCTGAAACGTGCCTGGTGG + Intergenic
1063470881 10:6283868-6283890 TCTGACTGAATCCTGCCATGGGG - Intergenic
1064898143 10:20262486-20262508 GCAGCCTGGAGGCTGCCTGGAGG - Intronic
1067803219 10:49374460-49374482 GATGGCACAAGCCTGCCAGGGGG - Intronic
1069979596 10:72242987-72243009 GCTCCCAGCAGCCTGGCAGGAGG + Intergenic
1070674349 10:78402058-78402080 GCTGCCAGCAGCCTTCCAGCAGG + Intergenic
1072788840 10:98303104-98303126 CCTGCCTGAAGCCACCCAGCTGG + Intergenic
1075027969 10:119000897-119000919 GCAGCCAGGAGCCGGCCAGGAGG - Intergenic
1075030768 10:119023361-119023383 GCTGCCTGGAGGCTGACAGGCGG - Intergenic
1075259376 10:120949496-120949518 GCTGTCAGAAGGCAGCCAGGCGG + Intergenic
1076319124 10:129565098-129565120 GCTGCGTGTAGCCTGCCCGGCGG + Intronic
1076725283 10:132410248-132410270 GGTGCCTGAGGCCTGGCTGGAGG + Intronic
1078545426 11:12243548-12243570 GATTCCTCATGCCTGCCAGGAGG + Intronic
1083336241 11:61923480-61923502 GCTGCCTTGAGCCTGCCAGCTGG - Intergenic
1083525487 11:63361043-63361065 TCTGCCTGAACTCTGCCAGTAGG - Intronic
1083591293 11:63896748-63896770 TCTGCTTGAAGCTTTCCAGGAGG + Intronic
1084208443 11:67609536-67609558 GCTGCTGGAAGGCTGCCTGGTGG + Exonic
1085707732 11:78801692-78801714 GCTGCCTGCTGCCTCCTAGGAGG - Intronic
1089328013 11:117670581-117670603 GCTGCGTGAAGGCTGACGGGAGG + Intronic
1089681067 11:120119278-120119300 GATGCTTCAAGCCTGGCAGGTGG - Intronic
1090022138 11:123137599-123137621 GCAGCCTGCAGCCTGCTCGGGGG - Intronic
1090211118 11:124921558-124921580 CCTGTCTGCAGCCTTCCAGGAGG - Intronic
1090464948 11:126925447-126925469 GCTGCCTGAGGCCAGCTTGGGGG + Intronic
1090717451 11:129442750-129442772 CCTGTCTGGAGCCTGCCAGCAGG + Intronic
1091695782 12:2627225-2627247 GCTGCCAGCAGCCTGGGAGGAGG - Intronic
1091937805 12:4447221-4447243 GCTGCCTGCAGCCTGCAATGTGG - Intergenic
1092117280 12:6018542-6018564 GCTGCCTGGAGACATCCAGGTGG - Exonic
1092196121 12:6550760-6550782 GGAGGCTGATGCCTGCCAGGAGG - Exonic
1094432826 12:30388724-30388746 GCTTCCTGAAGCCTCCCCAGAGG - Intergenic
1095929303 12:47609742-47609764 TCTGCCTGAAACCTGGAAGGAGG + Intergenic
1097807297 12:63979998-63980020 ACTGCATGAATCCTGCCATGGGG - Intronic
1098800858 12:74955945-74955967 GCTTCCTGAAGCCTCCCCAGAGG + Intergenic
1099232562 12:80044096-80044118 CCTGCCTGAAGTCTGCAATGTGG - Intergenic
1101578893 12:106023731-106023753 TCTGACTGAATCCTGCCATGGGG - Intergenic
1102514929 12:113440011-113440033 GCTGCCTGAGGCCTGGAAAGGGG - Intergenic
1102927836 12:116840008-116840030 GCTCCCTGTAGCCTGTCAGAGGG - Intronic
1104031661 12:125069298-125069320 CCTCCCTGAAGCCTGCAGGGCGG - Intronic
1104820238 12:131672859-131672881 GTGGCCTGAAGCCAGCGAGGAGG - Intergenic
1104950823 12:132439149-132439171 GCTGACTGAAGGCAGCCATGAGG + Intergenic
1105001980 12:132695953-132695975 GCCTCCTGAGCCCTGCCAGGGGG - Exonic
1105705575 13:22965815-22965837 GCTGCCTGGGCCCTGCCAGCTGG + Intergenic
1105858480 13:24390800-24390822 GCTGCCTGGGCCCTGCCAGCTGG + Intergenic
1106555000 13:30801957-30801979 CCAGCCTTCAGCCTGCCAGGTGG + Intergenic
1106568570 13:30907008-30907030 GCTGCTTGAAGCCGCCCAGAAGG + Intronic
1107640963 13:42442833-42442855 TCTCCCTGAAGGCTGCCAGGTGG - Intergenic
1109692362 13:65909891-65909913 GCTGCCTGAACATTGCCAGTGGG - Intergenic
1112586239 13:100721363-100721385 GCAGCCTCAAGCCTTCCTGGGGG - Intergenic
1117528817 14:56639043-56639065 GCTGCCTGAAGACTAGTAGGTGG + Intronic
1119140700 14:72264962-72264984 TCTCCCTGATGCCTGCCAGGAGG + Intronic
1119421495 14:74510267-74510289 GATGCTTGGAGCCTGCCAGCGGG - Intronic
1120068007 14:80068514-80068536 GCTTCCTGTTGCTTGCCAGGAGG + Intergenic
1121417025 14:93786911-93786933 GTTGCCTAAAGCCTCCCAGCTGG + Intronic
1121495757 14:94390515-94390537 GTGGCCTGAAGGCTGGCAGGAGG + Exonic
1121555865 14:94836539-94836561 GGTGCCTGAAGCCAGACTGGAGG - Intergenic
1122028104 14:98892347-98892369 GGGACCTGAAGCCTGGCAGGGGG - Intergenic
1122199043 14:100110948-100110970 GCTTCCTGAGCCCTACCAGGAGG - Intronic
1123019930 14:105392931-105392953 GCTGCCCGAGGCCAGCCCGGGGG - Intronic
1124121378 15:26892011-26892033 TCTGCCTCACTCCTGCCAGGCGG - Intronic
1124250642 15:28104658-28104680 GCTGCCTGCAGCTGGGCAGGTGG - Intergenic
1125525143 15:40369772-40369794 ACTGGCTGAAGACTGCCTGGTGG - Exonic
1127930691 15:63595366-63595388 GCTTCCTGCAGCCTACCTGGAGG + Intergenic
1130303685 15:82699159-82699181 GGTGGCTGGAGCCAGCCAGGGGG + Intronic
1131259626 15:90881779-90881801 GCCCCCTGAAGCCTGGCAGGAGG + Exonic
1131345963 15:91648241-91648263 GCTGCCTCAAGCTTGGCAGTTGG + Intergenic
1131522194 15:93125070-93125092 GATGCCTGAAGCAGGCCAGGTGG - Intergenic
1131541981 15:93282085-93282107 GTTGCATGAAGGTTGCCAGGAGG + Intergenic
1132210865 15:100021146-100021168 TCGGCCTGAAGCCTCCCAGGTGG - Intronic
1132400515 15:101502132-101502154 GGAGTCTGAAGCCTGCCCGGGGG - Intronic
1132513247 16:354110-354132 GCTGCCTGGAGCATCCCGGGAGG - Intergenic
1132520611 16:386107-386129 GCTGCCTGCAGCCTGGCCGGAGG + Intronic
1133065565 16:3204285-3204307 GCTGCCTGGAGAGTCCCAGGAGG - Exonic
1133598018 16:7311604-7311626 TCTGCCTGAAGCCAGGCACGGGG + Intronic
1134250280 16:12569290-12569312 CCTTCCTGAAGCCAGCCATGGGG - Exonic
1134453399 16:14377125-14377147 CCTGGCTGTAGCCTGCCAGGAGG - Intergenic
1137582273 16:49640707-49640729 GCTGCCGGAAGCCTTGCAGTCGG - Intronic
1137802153 16:51271252-51271274 GCTGCCTGAAGCCTGCAGCCAGG - Intergenic
1140452558 16:75082405-75082427 CCAGCCTGCAGCCTGCCAGGTGG - Intronic
1140690966 16:77483363-77483385 GCTCCCAGAATCCTGCTAGGTGG - Intergenic
1141811608 16:86379741-86379763 GCTGCCTGAATCCTGGAGGGAGG + Intergenic
1143898641 17:10156708-10156730 GCAGCCTGCAGCCTGCTAGGAGG - Intronic
1145831402 17:27919413-27919435 GCTGCCTGAATGCTGTTAGGTGG - Intergenic
1146470728 17:33122193-33122215 GCTGCAGGAAGCATGCCAGTAGG - Intronic
1146490517 17:33278145-33278167 GCTGCCTGAAGCCAGGGAGCAGG - Intronic
1146955517 17:36934685-36934707 GCTGCGTGAGGCCTGCGGGGAGG - Intergenic
1147140828 17:38459757-38459779 GCTCCCTGCAGGCTGCCAGGTGG - Intronic
1148169237 17:45505392-45505414 CCTGCCTGTAGCCTGGGAGGGGG - Intergenic
1148346984 17:46909929-46909951 ATTGCCTTCAGCCTGCCAGGAGG - Intergenic
1148765838 17:50037772-50037794 GCAGCCAGATTCCTGCCAGGCGG + Intergenic
1148841132 17:50498120-50498142 ACTGCCTGGAGGCTGCCAGTGGG - Intergenic
1148859142 17:50595040-50595062 GCTGCCTGTCGACTCCCAGGGGG + Exonic
1149570167 17:57666726-57666748 CCTGCCTGCTACCTGCCAGGAGG - Intronic
1149641586 17:58206307-58206329 GCTGGCTGAACCCTTCCAGACGG + Exonic
1150229749 17:63543598-63543620 GCTGCCAGGAGCCTGTCGGGGGG - Exonic
1151975050 17:77479903-77479925 GCTTCCTGAAGCCAGACATGGGG - Intronic
1151977146 17:77489410-77489432 GCTGCATGTACCCTGGCAGGTGG + Intronic
1152021640 17:77782822-77782844 GGTGCCTGGAGCCTGCCAGCCGG + Intergenic
1152239522 17:79154142-79154164 GGTGGCTGGAGCCAGCCAGGTGG - Intronic
1152356377 17:79809681-79809703 GCGGCCTGGAGCCAGCCAGGTGG - Intergenic
1153945143 18:10011307-10011329 GCTGATAGAGGCCTGCCAGGAGG + Intergenic
1154387682 18:13910622-13910644 GCTTCCTGCAGCCTGCCTGGAGG + Intronic
1156609109 18:38705632-38705654 TCGGCCTGAGACCTGCCAGGAGG - Intergenic
1159886560 18:73913240-73913262 GATGCCTGATGCCTGCTAGAGGG + Intergenic
1160146194 18:76367160-76367182 GCTGCCTGAAGCCAGACCTGGGG + Intronic
1160969685 19:1762083-1762105 GCTGGCTCAAGACTGCCAGAGGG - Intronic
1161090668 19:2358436-2358458 GCAGCCTGCAGCCTGACAGGAGG + Intergenic
1161091511 19:2361911-2361933 GCTTCCTGACGCCTTCCTGGGGG + Intergenic
1161428612 19:4217821-4217843 GCTGCCTGCGGCCTGCGAGGAGG + Exonic
1161562170 19:4979490-4979512 GCTGCCTCCAGCATGCCAGGTGG - Intronic
1161613496 19:5257185-5257207 GCTGCCTCAAAGGTGCCAGGGGG - Intronic
1161843683 19:6697608-6697630 GCTTCTTGGAGGCTGCCAGGGGG - Intronic
1162973245 19:14193869-14193891 TCTGCCTGAAGGCTCCCAGAAGG + Intronic
1163294323 19:16402443-16402465 GCTGCATGAAAGCCGCCAGGAGG - Exonic
1163831232 19:19548067-19548089 GCTGGCTGCAGCTTTCCAGGCGG + Intergenic
1164100423 19:22050119-22050141 GCTGCCTGCATCCTGCCAACAGG - Intergenic
1164375356 19:27679242-27679264 AATGCCTGAAGTCAGCCAGGAGG + Intergenic
1165433993 19:35787011-35787033 GCTGACTGACGCCTGCCAGCAGG + Exonic
1165866874 19:38945101-38945123 GCTGACTGCTGCCTGGCAGGTGG - Exonic
1168695213 19:58400405-58400427 GCTGCCTGACACCACCCAGGGGG + Intergenic
925111457 2:1341775-1341797 GCTCCCTGAAGCCTGGCACATGG - Intronic
925905442 2:8537189-8537211 GCTGTGTGGAGCCTACCAGGAGG - Intergenic
926651903 2:15355775-15355797 GCTCCCTGAAGACTTCCCGGAGG + Intronic
927397671 2:22672770-22672792 GCTCCCTGAAGCCTGTAGGGGGG + Intergenic
929419393 2:41775577-41775599 GCTGCTTAAAACCTGCCAGATGG + Intergenic
932416503 2:71576644-71576666 GCTGACGGCTGCCTGCCAGGCGG + Intronic
932579615 2:72984882-72984904 CCAGCCTGAAGCCTGGGAGGTGG - Intronic
932603449 2:73146299-73146321 GCTCCCTGAATCCTCCCTGGAGG + Intronic
933713583 2:85344721-85344743 GCTGCTTCACACCTGCCAGGGGG + Exonic
934559241 2:95303764-95303786 GCTGCCCCAAGCCTGCCGGCTGG + Intronic
935063700 2:99630236-99630258 GCTGCATGAAGCTTGCAAAGGGG + Intronic
935700978 2:105811624-105811646 GTTGCATGAAGGATGCCAGGTGG + Intronic
938571288 2:132564120-132564142 GCCGCCTCAAGTCAGCCAGGAGG - Intronic
939050274 2:137299044-137299066 GCTGCATGAAGGCAGCCAGAAGG + Intronic
944069405 2:195652633-195652655 TCTCTCTGAAGCCTGCTAGGTGG - Intronic
946376040 2:219309379-219309401 GCTGGCGGGAGCCTGCCAGAGGG + Exonic
947612792 2:231533975-231533997 CCTGCCTGAAGCCTGTGAGCTGG - Intergenic
947753188 2:232543351-232543373 GGTGCCTGAAACCTCCCAGGCGG + Exonic
948537539 2:238657516-238657538 GCTGGCTGAAGCCTGGAAGATGG - Intergenic
948578499 2:238969146-238969168 GCCGCCCGCAGCCTGCCAGGAGG + Intergenic
948794880 2:240397412-240397434 CCTGCCAGAGGCCTGCCATGGGG - Intergenic
1170878369 20:20272334-20272356 GGAGGCTGAAGCATGCCAGGAGG + Intronic
1170896221 20:20417087-20417109 GATGGCTGAAGCGTCCCAGGTGG - Intronic
1171294876 20:24008661-24008683 GCTGCATCAAGCCTGCCTGGAGG - Intergenic
1171374828 20:24685385-24685407 CCTGCCTGGGGCCTGCCAGGTGG + Intergenic
1171946049 20:31378348-31378370 GCTGCCTGGATACTGCCAGGTGG - Intronic
1173552089 20:43939473-43939495 GCTGCCAGAACCCAGCCAGGGGG + Intronic
1174987544 20:55471976-55471998 GCTGTCTGAAGCCTGCTGTGTGG - Intergenic
1175734059 20:61373104-61373126 GCTGCCCTAAGCCAGCCATGGGG - Intronic
1175783058 20:61695931-61695953 GGTGCCTGAGGCCTGGCAGCGGG - Intronic
1175844326 20:62050733-62050755 TCTGCCTGGAGCCTGGCAGGTGG - Intronic
1176051592 20:63122564-63122586 TCTGACTTAAGCCTGCCTGGAGG + Intergenic
1176259331 20:64171382-64171404 GCTGCCTGGAGCCTGTCTCGGGG + Intronic
1176360898 21:5995809-5995831 GCTGCCTGCAGCTTGGCTGGGGG + Intergenic
1178405419 21:32319279-32319301 GCTCCCAGGAGCCTGCCAAGCGG - Exonic
1179639385 21:42737137-42737159 GCTGCCAGAAGCTAGCCAGATGG + Intronic
1179762620 21:43542741-43542763 GCTGCCTGCAGCTTGGCTGGGGG - Intronic
1179821579 21:43940207-43940229 GCTGCCTGAAGCCGGCGAGAAGG - Intronic
1180103932 21:45605107-45605129 GCTGCCTGCAGCTTGGCTGGGGG + Intergenic
1181100377 22:20534928-20534950 GCTTCCTGAAGCCTGAAGGGAGG - Intronic
1182029670 22:27147974-27147996 ATTGCCTGAAGCCTGCTGGGTGG - Intergenic
1182417826 22:30232786-30232808 GGTGCATGAATCCTGCCACGTGG + Intergenic
1183606836 22:38871295-38871317 GCTGGCTGAGGCCTGCCATCAGG + Intronic
1183657046 22:39192297-39192319 GCTGCCTCATTACTGCCAGGTGG - Intergenic
1183686431 22:39363694-39363716 GCTGCCTGGGGACTGCCTGGAGG + Intronic
1183748106 22:39703938-39703960 GCTGACAGTCGCCTGCCAGGGGG + Intergenic
1184098691 22:42330150-42330172 GCAGCCTCCAGCCTGCCTGGTGG - Intronic
1184112606 22:42404071-42404093 GATGCATGAAGTCTGCCCGGAGG - Intronic
1184253914 22:43276418-43276440 CCCGCCTGAGGCCAGCCAGGTGG - Intronic
1184566764 22:45296714-45296736 GCTGCCGGATGCCTGGGAGGGGG + Intergenic
1185348274 22:50320060-50320082 GCTGCCTGAAGCCTGCCAGGAGG + Intronic
949125991 3:445657-445679 GCTGCCTGAGGCCTCCCCTGAGG - Intergenic
949510340 3:4761595-4761617 GCTACCTCACACCTGCCAGGTGG + Intronic
949829141 3:8196204-8196226 GCTGCCTGGAGCTGGGCAGGGGG + Intergenic
950685840 3:14618174-14618196 GCTGACGGGAGCCTCCCAGGAGG - Intergenic
954707809 3:52490308-52490330 GCTGCCTGAAGCCACACAGCTGG - Intronic
954807258 3:53227766-53227788 GTGGCCTGGAGCCTGCCAGCTGG - Intronic
956814393 3:72894729-72894751 GTTGCATGAAGATTGCCAGGTGG + Intronic
956848605 3:73207085-73207107 GCTGCCTAATCCCTGGCAGGTGG - Intergenic
959860108 3:111206962-111206984 ACTGCCTGAAGCAAGGCAGGTGG - Intronic
959973919 3:112437169-112437191 CCTGCCTGAACTCTGCCAGTGGG + Intergenic
961375970 3:126466049-126466071 ACTGCCTGACGCCTTCCAAGAGG + Intronic
961649412 3:128410013-128410035 GCTGACTGAAGCCCTCCTGGAGG - Intergenic
963756370 3:149238899-149238921 TCTCTCTGAAGCCTGCTAGGTGG - Intergenic
966917674 3:184593881-184593903 TCTGCCTGCAGCCTGCCAGCTGG - Intronic
968649412 4:1754497-1754519 GCTGCCTGAGGCCAGGGAGGGGG + Intergenic
968688426 4:1976914-1976936 GCTGCCTGAATCCCTCCTGGAGG - Intronic
968917042 4:3501081-3501103 GCTGCCTGATGCCTGGAAGCAGG - Intronic
969575500 4:8033981-8034003 GATGCCCCAAGGCTGCCAGGAGG + Intronic
971228844 4:24781016-24781038 GTTGCCTCAAGGCTGCAAGGTGG - Intergenic
971864507 4:32152138-32152160 GCTGGCTTAAGCCTGGGAGGTGG - Intergenic
975299697 4:72775200-72775222 ACCACCTGAAGCCTGCCAGCTGG + Intergenic
975464392 4:74693062-74693084 GCTGCCTGAATCCTGGCATCTGG - Intergenic
975813984 4:78198231-78198253 ACTGACTGAAGGCTGTCAGGGGG - Intronic
979614201 4:122723638-122723660 ACTACCTGAAACCTGGCAGGTGG + Intergenic
980137508 4:128872925-128872947 GCTGCTTGAAGCCTGTGAGTGGG + Exonic
981286723 4:143026502-143026524 TCTGCCTGAACCCTGCCAGTAGG + Intergenic
983895253 4:173074558-173074580 GCTGCCTTAAGCATGACAGCAGG - Intergenic
984705521 4:182844773-182844795 CCTCCCTGAAGCCTCTCAGGTGG - Intergenic
984811380 4:183798318-183798340 GGTGCCTGAGGCCGGCCAGGTGG + Intergenic
985479841 5:102620-102642 GCTCCCTGAAGCCTCCCCAGAGG + Intergenic
986734019 5:10654980-10655002 GCTGCCAGGAGTCTGTCAGGAGG - Intergenic
988997264 5:36726211-36726233 AATGCATGAAGCCTGCCACGTGG - Intergenic
992001868 5:72443995-72444017 GCTGGAGGAAGCCTGCAAGGAGG - Exonic
992506699 5:77394356-77394378 GCTACCTGAAGAGTGCGAGGAGG - Intronic
993342236 5:86738869-86738891 GCTGCCTAAAGACTGCATGGTGG - Intergenic
997239742 5:132297499-132297521 CCTGCCTGGAGTCAGCCAGGTGG - Intronic
997265346 5:132491660-132491682 GTTCCCTAAAGCCAGCCAGGGGG - Intergenic
997779769 5:136644800-136644822 GCTTCCTGAAGCCTCCCCAGAGG + Intergenic
999133125 5:149299642-149299664 GCCGCCAGCAGCCTGCCTGGAGG + Intronic
1001334659 5:170787500-170787522 GTTTCCTGAAGCCTTCCAGCTGG - Intronic
1001648477 5:173299024-173299046 GATGCCAGGAGCCAGCCAGGGGG - Intergenic
1002193182 5:177489447-177489469 GCTGCCGGAGGGGTGCCAGGAGG - Exonic
1002522552 5:179799719-179799741 CCTGCCTGAAGCCTGCCCCTGGG - Intronic
1002524616 5:179808035-179808057 GCTGCCCAAAGCCTGCCCAGAGG - Intronic
1002835435 6:861498-861520 GGGGCCTGGGGCCTGCCAGGAGG - Intergenic
1003138944 6:3456050-3456072 GTTGCCCGCAGCCTCCCAGGGGG + Exonic
1007149189 6:39671297-39671319 GCTGCCTCAACCCTCCCTGGAGG + Intronic
1007351261 6:41275200-41275222 GCCTCCAGAAGCCTCCCAGGGGG + Exonic
1007665456 6:43510511-43510533 GCCGCCTGCCGCCTGCCAGTTGG - Exonic
1007778624 6:44238092-44238114 GGGGCCTGACGCCCGCCAGGGGG - Intergenic
1009939977 6:70280419-70280441 GCTTCCAGGAGCCTGCCAGTGGG + Intronic
1011191140 6:84729600-84729622 GCTTTATGAAGCCTGCCAAGGGG + Intronic
1011440371 6:87380833-87380855 GATGCCTTAAGCCTGGGAGGTGG - Intronic
1011994805 6:93572385-93572407 CCTCCCTTAAGCCAGCCAGGAGG - Intergenic
1012037857 6:94165929-94165951 TCTGCCTCAACTCTGCCAGGGGG + Intergenic
1012189927 6:96266406-96266428 GAGGCCTGAAACCTGGCAGGAGG - Intergenic
1014968995 6:127791555-127791577 ACGGCCTGAAGCCTGCCGGAGGG - Intronic
1015576311 6:134675282-134675304 TCTGCCTGATGCCTGGCAGGGGG - Intergenic
1015982681 6:138855079-138855101 TCTGATTGAAGCCTGCCAGGGGG - Intronic
1016426518 6:143941651-143941673 GCTGCCAGAAGCCCAACAGGGGG + Exonic
1017186769 6:151609369-151609391 GCTTCCTGAAACCTTCCAGCTGG + Intronic
1018559065 6:165082369-165082391 GTAGCCTGAGGCCTGCCAAGTGG - Intergenic
1019276831 7:180199-180221 GCTGCCTGAAGCCCACCCTGAGG + Intergenic
1019515879 7:1440010-1440032 GCTGCCTGAGACCTTCCTGGGGG + Exonic
1019572703 7:1720358-1720380 GCTGGCTCACGCCTGCCAGGAGG + Intronic
1019629957 7:2043746-2043768 GCTCCCTGGGGCCTGGCAGGAGG - Intronic
1021577224 7:22115678-22115700 GCTGTCTCAAGGCTTCCAGGTGG + Intergenic
1024279769 7:47709618-47709640 TCTGGCTGAAGGCTGCCTGGAGG - Intronic
1024722111 7:52148938-52148960 TCTCCCTGAAGCCTGCCACCTGG + Intergenic
1026562001 7:71458105-71458127 GCTGCCTGAGCCCTGGCAGCAGG - Intronic
1026775683 7:73229750-73229772 GCTGCCTGAGCCTTGGCAGGGGG - Intergenic
1027016541 7:74783122-74783144 GCTGCCTGAGCCTTGGCAGGGGG - Intronic
1027071487 7:75162814-75162836 GCTGCCTGAGCCTTGGCAGGGGG + Intergenic
1028605645 7:92652528-92652550 TCTGCCTGAAGCTTTTCAGGGGG + Intronic
1031386929 7:121162746-121162768 GTTGCCTGAAGGCTCCCATGTGG - Intronic
1031650104 7:124278067-124278089 GCAGTCTGAAGGCTGTCAGGCGG + Intergenic
1032479469 7:132235056-132235078 GCTGGTTGAAGCCTTCCAAGGGG + Intronic
1033273110 7:139950611-139950633 GCTCCATGAAGGCTGCCACGTGG - Intronic
1034869421 7:154670422-154670444 GCTGCCTACAGCCTGACAGCGGG - Intronic
1035063943 7:156091867-156091889 GCTCCCTGAAGGCTGCCCAGGGG + Intergenic
1035398581 7:158550600-158550622 GCTCCCAGACGCCTCCCAGGTGG + Intronic
1035466767 7:159084508-159084530 GGAGCCTGAAGCCTGGCAGAGGG - Intronic
1036219833 8:6912085-6912107 TCTCCCTGAAGCCTCCCTGGAGG + Intergenic
1037909280 8:22734065-22734087 GCTGCCTGCAGGCTGCCAAGTGG + Intronic
1037932541 8:22890653-22890675 GCTACCTGCCACCTGCCAGGCGG - Intronic
1037957860 8:23072656-23072678 ACAGCCTGGAGCCTGTCAGGCGG + Intergenic
1038270235 8:26069007-26069029 ACTGCCAGAAGCCAGGCAGGAGG + Intergenic
1038395883 8:27245022-27245044 GCTGGCTGGAGACTGGCAGGAGG + Intronic
1040655216 8:49500141-49500163 ACTGCCTCATGACTGCCAGGTGG + Intergenic
1041811314 8:61913766-61913788 TCTGCCTGGGGCCTGCCATGGGG + Intergenic
1042006072 8:64181999-64182021 GCTGACTGAATGCAGCCAGGTGG + Intergenic
1042942797 8:74124796-74124818 GCTGCCTTAAACCTGGCAGGAGG + Intergenic
1043060557 8:75496319-75496341 GCTGCTAGAACCCTGCCAGTAGG - Intronic
1044241352 8:89892526-89892548 GCTGCCTGAGTTCTGCCTGGTGG - Intergenic
1046763593 8:118046322-118046344 GTTGCCTGAAGCTTTCCAGCAGG - Intronic
1047093092 8:121594946-121594968 GATGCGTGAAGGTTGCCAGGTGG - Intergenic
1047213222 8:122856648-122856670 GTTCCCTGAGGCCTGGCAGGAGG + Intronic
1048514258 8:135091447-135091469 TATGCCTGGAGCCTTCCAGGAGG + Intergenic
1048549495 8:135421324-135421346 GCTGCCTGATGGCTGTGAGGTGG - Intergenic
1048571300 8:135659383-135659405 GCTGCCTTGTTCCTGCCAGGTGG + Intergenic
1049213644 8:141398013-141398035 TCTGCCTGAGGCCTGCTTGGAGG + Intronic
1049278220 8:141730564-141730586 GCTGCCTGAAGCCTGCAGCCAGG + Intergenic
1049658402 8:143808931-143808953 GCCCCCTGGACCCTGCCAGGCGG - Exonic
1049787404 8:144457585-144457607 GCTGCCTGTAGCCAGCAGGGGGG - Intronic
1049915345 9:312030-312052 GCAGCCTGCAGCCTGACAAGCGG + Exonic
1053549187 9:39057453-39057475 TCTGACTGAATCCTGCCATGGGG - Intergenic
1053813315 9:41877537-41877559 TCTGACTGAATCCTGCCATGGGG - Intergenic
1054617281 9:67309902-67309924 TCTGACTGAATCCTGCCATGGGG + Intergenic
1055004454 9:71489314-71489336 GCTGCCTTCATCCTGCCATGGGG + Intergenic
1056210237 9:84358374-84358396 GTTACATGAAGGCTGCCAGGTGG - Intergenic
1057421364 9:94915630-94915652 GCTGCCTGAACTCTGTCAGCCGG + Intronic
1058376651 9:104329546-104329568 CCTGCCTGTAGGGTGCCAGGTGG - Intergenic
1059061378 9:111038203-111038225 GCGGCCTGAAGCCAGCCCGGGGG - Intronic
1059519345 9:114925329-114925351 GTTACATGAAGGCTGCCAGGTGG - Intronic
1060300378 9:122371424-122371446 GCTCCCTGAAGCCCCCCCGGCGG + Intronic
1061153902 9:128845652-128845674 GCTGCCTGGCGCCTGCCCAGTGG + Intronic
1061247605 9:129408924-129408946 GCTGCCAGAAACCTCCCAGAGGG - Intergenic
1062401670 9:136375493-136375515 GCAGCCTGACCCCAGCCAGGTGG + Intergenic
1186110116 X:6246626-6246648 GATGCCTGAAGCCAGTCAGGAGG - Intergenic
1187158758 X:16745189-16745211 CCTGCCTGCAGCCAGGCAGGAGG - Intronic
1189906462 X:45765518-45765540 GCTGCCTGATTTCTGCCAAGAGG + Intergenic
1194240090 X:91434981-91435003 GCTGCCTGCAGCCTGCCTGCCGG + Intronic
1194946109 X:100069676-100069698 GCTGCCTGAAGGCTGGAAGATGG - Intergenic
1197614808 X:128679319-128679341 GTTGAATGAAGCTTGCCAGGTGG - Intergenic
1198260989 X:134964796-134964818 GCTTCCTGAAGCCTCCCCAGAGG - Intergenic
1200906831 Y:8492332-8492354 CCTGCCTAAGCCCTGCCAGGAGG + Intergenic
1201645476 Y:16225040-16225062 GCTCCCTGTAGCCTGGCAAGAGG - Intergenic
1201657337 Y:16360272-16360294 GCTCCCTGTAGCCTGGCAAGAGG + Intergenic