ID: 1185348275

View in Genome Browser
Species Human (GRCh38)
Location 22:50320061-50320083
Sequence CTGCCTGAAGCCTGCCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 353}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185348270_1185348275 -4 Left 1185348270 22:50320042-50320064 CCCTGCAATGTCTCCTGGGCTGC 0: 1
1: 0
2: 3
3: 35
4: 277
Right 1185348275 22:50320061-50320083 CTGCCTGAAGCCTGCCAGGAGGG 0: 1
1: 0
2: 3
3: 44
4: 353
1185348264_1185348275 11 Left 1185348264 22:50320027-50320049 CCCATTCCCAGTGGGCCCTGCAA 0: 1
1: 0
2: 0
3: 16
4: 229
Right 1185348275 22:50320061-50320083 CTGCCTGAAGCCTGCCAGGAGGG 0: 1
1: 0
2: 3
3: 44
4: 353
1185348267_1185348275 4 Left 1185348267 22:50320034-50320056 CCAGTGGGCCCTGCAATGTCTCC No data
Right 1185348275 22:50320061-50320083 CTGCCTGAAGCCTGCCAGGAGGG 0: 1
1: 0
2: 3
3: 44
4: 353
1185348258_1185348275 20 Left 1185348258 22:50320018-50320040 CCCAGAGCCCCCATTCCCAGTGG 0: 1
1: 0
2: 1
3: 36
4: 256
Right 1185348275 22:50320061-50320083 CTGCCTGAAGCCTGCCAGGAGGG 0: 1
1: 0
2: 3
3: 44
4: 353
1185348265_1185348275 10 Left 1185348265 22:50320028-50320050 CCATTCCCAGTGGGCCCTGCAAT 0: 1
1: 0
2: 0
3: 14
4: 223
Right 1185348275 22:50320061-50320083 CTGCCTGAAGCCTGCCAGGAGGG 0: 1
1: 0
2: 3
3: 44
4: 353
1185348260_1185348275 19 Left 1185348260 22:50320019-50320041 CCAGAGCCCCCATTCCCAGTGGG 0: 1
1: 0
2: 2
3: 33
4: 314
Right 1185348275 22:50320061-50320083 CTGCCTGAAGCCTGCCAGGAGGG 0: 1
1: 0
2: 3
3: 44
4: 353
1185348263_1185348275 12 Left 1185348263 22:50320026-50320048 CCCCATTCCCAGTGGGCCCTGCA No data
Right 1185348275 22:50320061-50320083 CTGCCTGAAGCCTGCCAGGAGGG 0: 1
1: 0
2: 3
3: 44
4: 353
1185348266_1185348275 5 Left 1185348266 22:50320033-50320055 CCCAGTGGGCCCTGCAATGTCTC 0: 1
1: 0
2: 1
3: 15
4: 157
Right 1185348275 22:50320061-50320083 CTGCCTGAAGCCTGCCAGGAGGG 0: 1
1: 0
2: 3
3: 44
4: 353
1185348271_1185348275 -5 Left 1185348271 22:50320043-50320065 CCTGCAATGTCTCCTGGGCTGCC 0: 1
1: 0
2: 2
3: 18
4: 244
Right 1185348275 22:50320061-50320083 CTGCCTGAAGCCTGCCAGGAGGG 0: 1
1: 0
2: 3
3: 44
4: 353
1185348262_1185348275 13 Left 1185348262 22:50320025-50320047 CCCCCATTCCCAGTGGGCCCTGC 0: 1
1: 0
2: 3
3: 31
4: 324
Right 1185348275 22:50320061-50320083 CTGCCTGAAGCCTGCCAGGAGGG 0: 1
1: 0
2: 3
3: 44
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185348275 Original CRISPR CTGCCTGAAGCCTGCCAGGA GGG Intronic
900153988 1:1196786-1196808 CTGCCTGGGGCCTGCCAGTGTGG - Intronic
900291542 1:1925736-1925758 CTGGCTCCAGCCTCCCAGGAGGG - Intronic
900432005 1:2606888-2606910 CGGTCTGAGGCCTTCCAGGAGGG - Intronic
900570347 1:3355218-3355240 GGGCCTGAGGCCTGGCAGGAGGG + Intronic
900600225 1:3499704-3499726 CTGTCTGCAGCCTGCCCGGCCGG - Exonic
900772958 1:4560505-4560527 CTCCCTGAAGCCACCCAGCAAGG - Intergenic
900967159 1:5966771-5966793 CTGCCTGGAGGATGACAGGAAGG - Intronic
901219342 1:7574325-7574347 GTGCCTGAACCCACCCAGGAAGG + Intronic
901229284 1:7633022-7633044 TAGCCTGAACCTTGCCAGGAGGG - Intronic
902160158 1:14523407-14523429 CTGCCTGGAGCCTCCCAGCTCGG + Intergenic
904252366 1:29234301-29234323 CAGCATGAAGCCAGCTAGGAGGG + Intergenic
904290979 1:29485716-29485738 ATGCCTGACCCCAGCCAGGAGGG - Intergenic
904905369 1:33893937-33893959 CTGGCTGCAGCCTGCTAGAAGGG + Intronic
906532231 1:46530482-46530504 GGGCCTGAAGCCTGCCTGGGAGG + Intergenic
906695076 1:47818133-47818155 CTGCCCCAGGCCTGCCAGTATGG + Intronic
908458825 1:64329789-64329811 GTGCCTGAAGCTTTCCAGGTGGG - Intergenic
908858490 1:68455774-68455796 CTGTCTGAGGCATTCCAGGAAGG - Intergenic
909751416 1:79165872-79165894 GTCCCTGAAGGCAGCCAGGAGGG + Intergenic
910288152 1:85576921-85576943 CGGCCGCAAGCCTGCCAGGCCGG + Intronic
910820945 1:91345554-91345576 CTGCCTTAAATCTGTCAGGAAGG - Intronic
912517012 1:110222868-110222890 CTGCATGAAGGTTACCAGGAAGG - Intronic
913936979 1:125064614-125064636 CAGCCTCAGGCCTGCCCGGACGG - Intergenic
915488188 1:156236413-156236435 CTGCCTCCGCCCTGCCAGGACGG - Exonic
915594716 1:156889860-156889882 TCCCCTGAGGCCTGCCAGGAAGG - Intergenic
918141601 1:181724627-181724649 CTGACTCAGGCCTGCCAGGAAGG + Intronic
919999903 1:202789731-202789753 CTGTCTTAAGCCTCCCAGGTAGG - Intronic
920011933 1:202874238-202874260 CTGCTGGAAGGCGGCCAGGATGG - Intergenic
922606465 1:226892671-226892693 CTCCCCCAAGCCTGCCTGGAGGG - Intronic
922844028 1:228668810-228668832 CTGGCTCAAGCCTTCCAGGTAGG - Intergenic
923545302 1:234919169-234919191 CTGAGTGATGCCTGCCCGGAAGG - Intergenic
923964760 1:239125161-239125183 CTGCTTGGAGCCTGTTAGGATGG + Intergenic
1063339772 10:5252364-5252386 CTGCCCGCAGCCTTCCAGGTGGG + Intergenic
1064226505 10:13490542-13490564 ATGCATGCAGCCTGCCAGGCAGG - Intronic
1064898142 10:20262485-20262507 CAGCCTGGAGGCTGCCTGGAGGG - Intronic
1067027829 10:42859244-42859266 CTCCCTGAAACCCACCAGGAAGG + Intergenic
1067232285 10:44420187-44420209 CTTCCTGAAGGCTGGCAGGGAGG + Intergenic
1067428018 10:46223909-46223931 ATGGATGAAGCCTGTCAGGAGGG + Intergenic
1067838345 10:49655490-49655512 GTGCCTGGGGCCTGCCAGAATGG + Intronic
1068774488 10:60855688-60855710 CTCCCTGAAGCCAGCCAGGTAGG - Intergenic
1069652528 10:70060067-70060089 CTGCCTGAGGACTGACAGCAGGG + Intronic
1069984691 10:72275085-72275107 CTGGCTGAAGCCAGGGAGGAAGG - Exonic
1070169240 10:73920276-73920298 CTGGCTTAACCCTGCCAGTAGGG - Intronic
1070312430 10:75283492-75283514 CAGCCTGGAGCATTCCAGGAGGG + Intergenic
1070512442 10:77173820-77173842 GTGCCCGAAGCCTGGAAGGAAGG - Intronic
1070674350 10:78402059-78402081 CTGCCAGCAGCCTTCCAGCAGGG + Intergenic
1070806922 10:79276129-79276151 CTCCCTGCAGCCTGGGAGGAAGG + Intronic
1075519382 10:123135055-123135077 TTTCCTAAAGCCTGCTAGGAAGG - Intergenic
1076183969 10:128432180-128432202 GGGCATGAAGCCTGCCAAGAAGG - Intergenic
1076236513 10:128867769-128867791 CTTCCTGAGGCTTCCCAGGAAGG + Intergenic
1076319125 10:129565099-129565121 CTGCGTGTAGCCTGCCCGGCGGG + Intronic
1076634767 10:131875171-131875193 CTGCCGGGACCATGCCAGGAAGG + Intergenic
1077046632 11:549604-549626 ATGCCTGCAGCCTGCCAGGGAGG + Intronic
1077128332 11:955360-955382 CAGCCTGATGCCCCCCAGGATGG - Intronic
1077170902 11:1165285-1165307 CTGCCTGACCCCTGCAGGGACGG + Exonic
1077557439 11:3232385-3232407 CTCCCTGCAGCCTTCCAGGCAGG + Exonic
1078004629 11:7523251-7523273 CAGCCTCCAGCCTCCCAGGATGG + Intronic
1078084711 11:8226911-8226933 CAGCCTGAGGCCTGCTGGGATGG - Intronic
1080760499 11:35244495-35244517 CTGACTGATACCTGCAAGGATGG + Intergenic
1083336240 11:61923479-61923501 CTGCCTTGAGCCTGCCAGCTGGG - Intergenic
1084014389 11:66370063-66370085 CTGCCTGGAGCTTAGCAGGATGG - Intronic
1084173072 11:67409859-67409881 CTGCCTGGTCCTTGCCAGGAAGG - Exonic
1084670863 11:70605875-70605897 GGGCCTGAAGCCAGCGAGGAAGG + Intronic
1085707731 11:78801691-78801713 CTGCCTGCTGCCTCCTAGGAGGG - Intronic
1088727663 11:112653822-112653844 TTTCATGAAGCCTGCCAGCAAGG + Intergenic
1088758864 11:112910467-112910489 CTGAGAGAAGGCTGCCAGGAGGG + Intergenic
1089220878 11:116870398-116870420 CTGCCTGAAGAGAGACAGGAAGG + Exonic
1089260739 11:117222228-117222250 CTGCCTTAAACCTGCTGGGATGG + Intronic
1089328014 11:117670582-117670604 CTGCGTGAAGGCTGACGGGAGGG + Intronic
1090260429 11:125315096-125315118 CTGGCTGAAGCCTGCTCAGAGGG + Intronic
1091937804 12:4447220-4447242 CTGCCTGCAGCCTGCAATGTGGG - Intergenic
1091994368 12:4981703-4981725 CTGTCTCCAGCCTGTCAGGAAGG + Intergenic
1095038841 12:37421317-37421339 CAGCCTCAGGCCTGCCTGGACGG - Intergenic
1095039182 12:37423238-37423260 CAGCCTCAGGCCTGCCAGTACGG - Intergenic
1095049196 12:37541866-37541888 CAGCCTCAGGCCTGCCCGGACGG + Intergenic
1095175654 12:39089117-39089139 ATCCCTGATGCATGCCAGGAGGG + Intergenic
1096180934 12:49549983-49550005 GTTCCTGAGGCCTGCCAGGGTGG + Intronic
1096185933 12:49580600-49580622 CTGCGGGAAGACTGACAGGAGGG - Intronic
1099227260 12:79984173-79984195 CTGTTTGAAACCTGCAAGGAGGG + Intergenic
1099523428 12:83690903-83690925 CTGCCTGGAGCCTGGGGGGAGGG - Intergenic
1099985407 12:89657180-89657202 CTGACTGAAGCCGGAAAGGATGG - Intronic
1101559934 12:105847230-105847252 CTGCCTGGAGACAGTCAGGATGG + Intergenic
1101797851 12:107992333-107992355 CAGCCTGACTCCTGCCAGGCTGG + Intergenic
1103207614 12:119142588-119142610 CTACCTGGAGGCTGCCAGGCTGG - Intronic
1103704943 12:122866398-122866420 CTGCCTGGAGCCGGCCCTGAAGG - Exonic
1104031660 12:125069297-125069319 CTCCCTGAAGCCTGCAGGGCGGG - Intronic
1104385985 12:128352002-128352024 CTGTCTGAAGGCTGTCAGGCAGG + Intronic
1105620402 13:22060957-22060979 CTGCCTGTATCCTCCCATGAAGG + Intergenic
1105813162 13:24011723-24011745 CTGCATGCCCCCTGCCAGGAAGG - Intronic
1106568571 13:30907009-30907031 CTGCTTGAAGCCGCCCAGAAGGG + Intronic
1107562280 13:41568295-41568317 TTCTCTGAAGCCTGCCAGGATGG + Exonic
1110714790 13:78689497-78689519 CTGACTGAAACCTCCCAGGCTGG + Intergenic
1113039797 13:106092315-106092337 ATGCATGAAGCCTGCGGGGAAGG - Intergenic
1113472856 13:110559112-110559134 CTGCTTGTAGCCTGCAAGGCAGG - Intronic
1113843000 13:113371099-113371121 CTTCCTGAAGGCTTCCTGGATGG - Intergenic
1115571315 14:34669154-34669176 CTGCCTGAGGCCAGGCATGATGG + Intergenic
1115879253 14:37896532-37896554 CTGAATGAAGCCTTGCAGGATGG + Intronic
1118726386 14:68631976-68631998 CTGAGTGAAGCAGGCCAGGAAGG + Intronic
1118913072 14:70078027-70078049 CTGACAGGAGCCAGCCAGGAAGG + Intronic
1119091787 14:71789637-71789659 CTGCCTGAGGACTGCATGGAGGG - Intergenic
1119140701 14:72264963-72264985 CTCCCTGATGCCTGCCAGGAGGG + Intronic
1121100974 14:91250078-91250100 CTTCCTGTAGCCTGCTGGGAAGG + Intronic
1121555864 14:94836538-94836560 GTGCCTGAAGCCAGACTGGAGGG - Intergenic
1122127759 14:99588303-99588325 CTGGCTGAAGCCACCCTGGATGG - Intronic
1122596839 14:102899590-102899612 GTGCCTGGAGCTGGCCAGGAAGG - Intronic
1123427480 15:20184074-20184096 CTCCCTGAAGCCCACAAGGAAGG + Intergenic
1123536716 15:21190624-21190646 CTCCCTGAAGCCCACAAGGAAGG + Intergenic
1123998290 15:25733935-25733957 CTGCCTGCAGCCAGCCAGCCAGG - Intronic
1124381842 15:29173557-29173579 CTGGCGGAATCCTCCCAGGAGGG - Intronic
1125491870 15:40154611-40154633 CAGCCTGAAGGATGCCTGGAAGG + Intergenic
1126336256 15:47589153-47589175 CTGAAGGAAGCCTGCCGGGAGGG - Intronic
1127382963 15:58445349-58445371 CTGGCTGAAGCCAGCCTGTATGG - Intronic
1127753313 15:62067320-62067342 CTGCCTTAGGCCAGCCAGGGCGG + Intronic
1128848001 15:70918273-70918295 CTGAGTGCAGCCTGCCAGGGTGG + Intronic
1129970751 15:79775900-79775922 TTTCCTGAAGCCTCCTAGGAAGG - Intergenic
1131176466 15:90212327-90212349 CTGGCTGAAGCCTGTCGGGGTGG + Intronic
1131781660 15:95866161-95866183 ATGTCTGATGCCTGCCAGGTAGG + Intergenic
1132207498 15:99996375-99996397 CTGCCTCAACCCTTCCAGCAAGG + Intronic
1132221918 15:100111344-100111366 CTGCCCCTAGCCTGCCAGCACGG - Intronic
1132520612 16:386108-386130 CTGCCTGCAGCCTGGCCGGAGGG + Intronic
1133765155 16:8832721-8832743 CCGCCTGAAGCCTGCAAGCCCGG - Intronic
1134250279 16:12569289-12569311 CTTCCTGAAGCCAGCCATGGGGG - Exonic
1134320241 16:13156132-13156154 CTACATGAAGAATGCCAGGAAGG - Intronic
1134443113 16:14311004-14311026 CCCCCTGCAGCCTGCCAGGATGG + Intergenic
1134453398 16:14377124-14377146 CTGGCTGTAGCCTGCCAGGAGGG - Intergenic
1134891491 16:17845311-17845333 CTGCATGCAGCCAGCCATGAGGG - Intergenic
1134891621 16:17846252-17846274 CTGCATGCAGCCAGCCACGAGGG - Intergenic
1135170287 16:20177878-20177900 GTGAGTGAAGCATGCCAGGATGG + Intergenic
1136856815 16:33665735-33665757 CTCCCTGAAACCCACCAGGAAGG - Intergenic
1138488287 16:57360673-57360695 CTACCAGATGCCTGCCAGGATGG + Intronic
1138586363 16:57972841-57972863 TTGCCTGCAGCCTGACGGGAGGG + Intergenic
1139909899 16:70391293-70391315 CTGCTTGAAGCCAGCTAGAACGG - Intronic
1141096871 16:81169162-81169184 CAGCCTGAAGCCAGCAAGGCTGG - Intergenic
1141811609 16:86379742-86379764 CTGCCTGAATCCTGGAGGGAGGG + Intergenic
1203118388 16_KI270728v1_random:1514210-1514232 CTCCCTGAAACCCACCAGGAAGG - Intergenic
1143683066 17:8492006-8492028 CAGCCTGCATCCTGGCAGGAGGG - Intronic
1143898640 17:10156707-10156729 CAGCCTGCAGCCTGCTAGGAGGG - Intronic
1144012411 17:11162165-11162187 CTTCCTGAAGCCTCCCTAGAAGG + Intergenic
1145370200 17:22301145-22301167 CAGCCTCAGGCCTGCCCGGACGG + Intergenic
1145370960 17:22305542-22305564 CTGCCTCAGGCCTGCACGGACGG + Intergenic
1145379088 17:22377216-22377238 CAGCCTCAGGCCTGCCAGGACGG + Intergenic
1145380045 17:22381956-22381978 CAGCCTCAGGCCTGCCAGGACGG + Intergenic
1145381486 17:22389053-22389075 CAGCCTCAGGCCTGCCAGGACGG + Intergenic
1145382215 17:22392827-22392849 CAGCCTCAGGCCTGCCAGGACGG + Intergenic
1145382692 17:22395192-22395214 CAGCCTCAGGCCTGCCAGGACGG + Intergenic
1145382974 17:22396555-22396577 CAGCCTCAGGCCTGCCAGGACGG + Intergenic
1145383068 17:22397025-22397047 CAGCCTCAGGCCTGCCAGGACGG + Intergenic
1145383546 17:22399378-22399400 CAGCCTCAGGCCTGCCAGGACGG + Intergenic
1145384497 17:22404048-22404070 CAGCCTCAGGCCTGCCAGGACGG + Intergenic
1145384816 17:22405510-22405532 CAGCCTCAGGCCTGCCAGGACGG + Intergenic
1145384943 17:22406140-22406162 CAGCCTCAGGCCTGCCAGGACGG + Intergenic
1145385589 17:22409575-22409597 CAGCCTCAGGCCTGCCAGGACGG + Intergenic
1145385989 17:22411728-22411750 CAGCCTCAGGCCTGCCAGGACGG + Intergenic
1146470727 17:33122192-33122214 CTGCAGGAAGCATGCCAGTAGGG - Intronic
1146490516 17:33278144-33278166 CTGCCTGAAGCCAGGGAGCAGGG - Intronic
1146955516 17:36934684-36934706 CTGCGTGAGGCCTGCGGGGAGGG - Intergenic
1147242003 17:39096530-39096552 TTACCTGCAGCCTGGCAGGAAGG + Intronic
1148642389 17:49197873-49197895 GTGCCTGAAGTCTTCCAGGGAGG + Intergenic
1150489359 17:65563741-65563763 GGCCCTGAAGCCAGCCAGGAAGG + Intronic
1150618412 17:66789975-66789997 CTGCCTGATGCTGGCCAAGATGG - Intronic
1151852300 17:76698191-76698213 CTGCCTGCAGCAGGCAAGGATGG + Intronic
1152471042 17:80490195-80490217 CTCCCTGTGGCCTGCCAAGAAGG - Intergenic
1152699330 17:81811310-81811332 CTACCTGAGGCCCCCCAGGATGG - Exonic
1153295014 18:3536804-3536826 CTGGCTGAACCCTGCGATGAAGG + Intronic
1156945837 18:42830443-42830465 CTGAGTGAAGCCTCTCAGGAAGG - Intronic
1157381555 18:47222739-47222761 CTGCCTGAAGCCGACCAGGCTGG + Intronic
1158537293 18:58319617-58319639 CTGAGTGGAGCCTCCCAGGATGG - Intronic
1158704883 18:59783410-59783432 CTGTCAGAAGTCTGGCAGGAAGG + Intergenic
1160251792 18:77209905-77209927 CTGCCTGCAGCCACCCAGCACGG - Intergenic
1160340522 18:78085320-78085342 CTGCCTGCAACTTGCCAGGGTGG - Intergenic
1161090669 19:2358437-2358459 CAGCCTGCAGCCTGACAGGAGGG + Intergenic
1161122173 19:2534835-2534857 CAGCTTGAAGGCTGCCAGGCAGG + Intronic
1161562169 19:4979489-4979511 CTGCCTCCAGCATGCCAGGTGGG - Intronic
1162475976 19:10899537-10899559 CCTCCTGAGCCCTGCCAGGAGGG - Intronic
1162871387 19:13589376-13589398 CTGCCCGGCGCCTGCCAGGCTGG + Intronic
1164086718 19:21909305-21909327 CTGCCTCAGCCCTGCCCGGAGGG + Intergenic
1164313143 19:24063864-24063886 CTGCCTGAAGCCTGACCACAGGG + Intronic
1165422644 19:35729978-35730000 CTGCCTGAAGCCTGGCGCCACGG + Exonic
1165595363 19:37008053-37008075 CTGCCTCAGGCCTGCCCGGACGG + Intronic
1165600986 19:37055848-37055870 CAGCCCGAGGCCTGCCCGGATGG + Intronic
1165683328 19:37796393-37796415 CAGCCTCAGGCCTGCCCGGACGG - Intronic
1166275383 19:41750094-41750116 CTGCCTGGAGGCTTCCAGGGAGG + Intronic
1166280407 19:41788891-41788913 CTGCCTGGAGGCTTCCAGGGAGG + Intergenic
1166651051 19:44575486-44575508 CTGACTGGATCCTGCCATGATGG + Intergenic
1166941829 19:46371733-46371755 CAGCCTGAAGCCTGACATAAGGG - Intronic
1167101246 19:47405527-47405549 CTACCTGAGGCATGTCAGGATGG + Intronic
1167775026 19:51549118-51549140 GTGGCTGAGGGCTGCCAGGATGG - Intergenic
925423633 2:3731204-3731226 CTGCCTGGAGCCAGCCTGGTAGG - Intronic
926215045 2:10901141-10901163 CTGCCTGTGGCCTGCCAGGTTGG - Intergenic
927185849 2:20481931-20481953 CTGCCTGATGCCAGCCAGAAAGG - Intergenic
928402914 2:30992279-30992301 CTGACTAAAGGCTGGCAGGATGG + Intronic
930196379 2:48514821-48514843 CTTCCTGAAGGCAGCCAGCATGG - Exonic
932579614 2:72984881-72984903 CAGCCTGAAGCCTGGGAGGTGGG - Intronic
934529261 2:95075030-95075052 CAGCCTGAGGGCAGCCAGGATGG + Intergenic
934529592 2:95076769-95076791 CTGCCTGAGGGTAGCCAGGAAGG - Intergenic
934747649 2:96770065-96770087 CTGCATGGGGCCAGCCAGGAAGG - Intronic
936501797 2:113072536-113072558 CTGCCTGGAGCCTGCTGGGCTGG + Exonic
936922022 2:117698480-117698502 CAGCCTGAAGCCTGCAATCAAGG - Intergenic
937496806 2:122429169-122429191 CTGCCTGAATTCAGCCAGGGTGG - Intergenic
937907364 2:127058818-127058840 CTCCCGGAAGCATGCCAGGCTGG + Intronic
938138745 2:128779924-128779946 CTGCCTGGGGCCTGGGAGGAGGG + Intergenic
938464389 2:131516902-131516924 CTGCCTGAAGCCTGCTTGTCAGG - Intergenic
938748993 2:134310796-134310818 CAGACTGAAGCCAGCCATGATGG - Intronic
939050275 2:137299045-137299067 CTGCATGAAGGCAGCCAGAAGGG + Intronic
939117454 2:138076757-138076779 CTGCTTGACCTCTGCCAGGATGG - Intergenic
939956509 2:148531902-148531924 CTGCCTTAAGCCTGTCTGGGAGG - Intergenic
941857121 2:170242564-170242586 CTGCCTGAGTCCTGGCAGGCAGG + Intronic
946392312 2:219423881-219423903 CTGCCCAAGGCCAGCCAGGAGGG + Intronic
946467059 2:219921343-219921365 CAGGCTGAGGCCAGCCAGGAAGG - Intergenic
947269689 2:228320151-228320173 GTGCTTGAAGCCTGGCATGAAGG - Intergenic
947739530 2:232478833-232478855 CTGCCTGCAGACTGCGAGGAAGG + Intergenic
948674721 2:239590113-239590135 CTGCCCGAGGCCACCCAGGAGGG + Intergenic
948727309 2:239942914-239942936 CTTCGGGAAGCCTGCAAGGATGG + Intronic
1168832529 20:854474-854496 CTGTCTGGAGCCTGCCAGCCTGG + Intronic
1170603490 20:17859379-17859401 ATCCCTGAAGGCTGCCATGAGGG - Intergenic
1170960048 20:21017538-21017560 CAGCCAGAAGCCTGCAATGAAGG - Intergenic
1171374829 20:24685386-24685408 CTGCCTGGGGCCTGCCAGGTGGG + Intergenic
1171524044 20:25796056-25796078 CAGCCTCAGGCCTGCCCGGACGG - Intronic
1171533186 20:25865604-25865626 CAGCCTCAGGCCTGCCGGGATGG - Intronic
1171533628 20:25867964-25867986 CAGCCTCAGGCCTGCCCGGACGG - Intronic
1171543728 20:25985366-25985388 CAGCCTCAGGCCTGCCCGGACGG + Intergenic
1171552783 20:26059827-26059849 CAGCCTCAGGCCTGCCCGGACGG + Intergenic
1171847211 20:30284427-30284449 CAGCCTCAGGCCTGCCCGGATGG + Intergenic
1171847560 20:30286318-30286340 CAGCCTCAGGCCTGCCCGGACGG - Intergenic
1171946048 20:31378347-31378369 CTGCCTGGATACTGCCAGGTGGG - Intronic
1172183493 20:33017579-33017601 CTCCCTGAAGGCTGCTCGGAGGG + Intronic
1172642120 20:36446836-36446858 CTGCGAGCAGCCTGCCTGGATGG - Exonic
1173624943 20:44465856-44465878 CAGCTTGAAGCCAGCCAGGATGG - Intergenic
1173927791 20:46793599-46793621 GTGCCTGAGGCTGGCCAGGATGG + Intergenic
1174086528 20:48012497-48012519 ATGCCTGAAGTCTGCCATGCTGG + Intergenic
1174267885 20:49345076-49345098 CAGGCTGTACCCTGCCAGGATGG - Intergenic
1174598344 20:51702941-51702963 CTGCCGGAGGCCTGTTAGGAGGG - Intronic
1175299674 20:57934104-57934126 CTCCCTGAAGTTTACCAGGAAGG + Intergenic
1175404201 20:58716423-58716445 CTGCCTGGGGCCCCCCAGGAAGG + Intronic
1175901462 20:62361474-62361496 CTCCCTGGAGCCTGGCTGGAGGG - Intronic
1175904983 20:62375295-62375317 GTGCCTGTCCCCTGCCAGGAGGG + Intergenic
1176051593 20:63122565-63122587 CTGACTTAAGCCTGCCTGGAGGG + Intergenic
1176656478 21:9592601-9592623 CAGCCTCAGGCCTGCCCGGATGG - Intergenic
1179174263 21:38995959-38995981 CTGCCTGAAGCAAGCAAGCAGGG - Intergenic
1179462504 21:41547202-41547224 CTGCCAGCAGCCTCCCAGCATGG - Intergenic
1179464288 21:41561491-41561513 GTGCCTGAAGCCTGCCTCTATGG + Intergenic
1181027902 22:20136137-20136159 TTGGCTGGAGCCAGCCAGGAGGG + Intronic
1181621160 22:24092170-24092192 CACCCTGTAGCCTGGCAGGAGGG + Intronic
1182029669 22:27147973-27147995 TTGCCTGAAGCCTGCTGGGTGGG - Intergenic
1182367245 22:29787542-29787564 CTTCCTGCTGCCTGTCAGGACGG + Intergenic
1183606837 22:38871296-38871318 CTGGCTGAGGCCTGCCATCAGGG + Intronic
1184112605 22:42404070-42404092 ATGCATGAAGTCTGCCCGGAGGG - Intronic
1184249894 22:43253993-43254015 CTGACTCATGCCTGCCTGGAGGG + Intronic
1184253912 22:43276417-43276439 CCGCCTGAGGCCAGCCAGGTGGG - Intronic
1184773940 22:46613890-46613912 CTGTCTCAAGCCTGCTGGGAGGG + Intronic
1184824822 22:46942665-46942687 CTTCCTGAAGCCGGCTTGGAGGG - Intronic
1185348275 22:50320061-50320083 CTGCCTGAAGCCTGCCAGGAGGG + Intronic
952408391 3:33025959-33025981 GTCCCTGAAGCCCGCCACGATGG + Intronic
952919016 3:38271926-38271948 CTGTCTGCAGCCTGCCATGGTGG - Intronic
953033403 3:39192092-39192114 CTGCCTGAAGCTTCCCTGGGAGG + Intronic
953412115 3:42696527-42696549 CTGTCTGCAGCCTGGGAGGATGG - Intronic
953786461 3:45915256-45915278 CTCCCTAAAGGCTGCAAGGAGGG - Intronic
955634232 3:61008399-61008421 CTGCCTGACACCTGCCAAGAAGG - Intronic
956765760 3:72482950-72482972 CTGCCTGAAGCTTAGGAGGAAGG + Intergenic
961588808 3:127959369-127959391 CTGCCTGAAGCCTGAGAGGAAGG + Intronic
961736033 3:129002684-129002706 CTCCCAGAAGCCTGGCAGGAAGG - Intronic
962281628 3:134056582-134056604 CTGCCTGAAGCTTGCCCTGCTGG - Intergenic
963258776 3:143172920-143172942 CTGCATAAAGCCTGCCAAAACGG - Intergenic
963850056 3:150202009-150202031 CTGCCTGTAGCCAGGCAGCAGGG + Intergenic
965910897 3:173774030-173774052 TTGCCAGAAGACAGCCAGGAAGG + Intronic
967012252 3:185446815-185446837 CTGGCTAAAGCCAGCAAGGATGG + Intronic
967690959 3:192472978-192473000 CTTTCTGGAGCCTGCCATGAAGG - Intronic
968828154 4:2914804-2914826 CTGCCTGCAGCCTGCCTGGGAGG + Intronic
968917041 4:3501080-3501102 CTGCCTGATGCCTGGAAGCAGGG - Intronic
971153991 4:24063276-24063298 CTCCCTCAAGCCTGACAAGAGGG + Intergenic
971161109 4:24135246-24135268 ATGCCTGAAGCCACTCAGGATGG - Intergenic
971285200 4:25282238-25282260 CTCCCTGAAGGCTTCCAGAAAGG - Intergenic
971938980 4:33189440-33189462 CACCCTGAGGGCTGCCAGGATGG - Intergenic
973796923 4:54436897-54436919 CTCCATGAAGCTGGCCAGGATGG + Intergenic
975299699 4:72775201-72775223 CCACCTGAAGCCTGCCAGCTGGG + Intergenic
975813983 4:78198230-78198252 CTGACTGAAGGCTGTCAGGGGGG - Intronic
975844744 4:78513255-78513277 CTTCCTGAAGCTTTCCAGGTAGG - Intronic
978037522 4:104014000-104014022 CTGCATGTAGTCTGCAAGGATGG + Intergenic
978782638 4:112572855-112572877 CTGCCTTAATCCTGCAAGAATGG + Intronic
980259666 4:130432413-130432435 CTCCCTCAACCCTGCCAGGAAGG + Intergenic
983895252 4:173074557-173074579 CTGCCTTAAGCATGACAGCAGGG - Intergenic
984811381 4:183798319-183798341 GTGCCTGAGGCCGGCCAGGTGGG + Intergenic
985048470 4:185965990-185966012 CTGCCGGATACCTGCGAGGAAGG - Intergenic
987984950 5:25134329-25134351 CTGCATGAAAGCAGCCAGGAGGG + Intergenic
988817260 5:34846711-34846733 CATCCTGAAACCTTCCAGGATGG - Intronic
989985312 5:50690154-50690176 CTTCCTGCAGCCTCTCAGGAGGG + Intronic
992350980 5:75928926-75928948 GTGCATGAAGCATGACAGGAAGG + Intergenic
992549415 5:77846832-77846854 CAGACCGCAGCCTGCCAGGAAGG - Intronic
998227984 5:140341663-140341685 CTGCCTCCAGCCTGTCAAGAAGG - Intronic
1001242159 5:170079236-170079258 CTTCCTGAAGCCTGCCACTGCGG + Intronic
1001929072 5:175659818-175659840 GAGCCTGAAGCCTGGCAGCAGGG + Intronic
1002193181 5:177489446-177489468 CTGCCGGAGGGGTGCCAGGAGGG - Exonic
1002783187 6:382569-382591 CTCCCTGAAGCCTATCAGGGTGG - Intergenic
1003599033 6:7501143-7501165 CTGACGGAAGGCTGTCAGGACGG + Intergenic
1005831752 6:29676700-29676722 CTCCATGAAGGATGCCAGGATGG + Intronic
1006319740 6:33313443-33313465 CCGCCTGAAGGCAGCCTGGAGGG + Exonic
1006503396 6:34472722-34472744 GTGCCTGAAACCTGGCGGGATGG + Intronic
1006680651 6:35794896-35794918 CTGCCTGAAGCCTGCCCTGGTGG + Intergenic
1007121569 6:39386615-39386637 CTGCTTGAACCCTTTCAGGAAGG - Intronic
1007244471 6:40450547-40450569 GTGCTGGAAGCCTGCAAGGAGGG + Intronic
1007281902 6:40719178-40719200 CTGTCTCAAGCCTGTAAGGATGG + Intergenic
1008698122 6:54065611-54065633 CTGCCTGAAGCATCCCAGAGAGG - Intronic
1011023213 6:82837010-82837032 CTGCATGAAGTCTCACAGGATGG - Intergenic
1012884769 6:104833052-104833074 CTGCATGTTGCCTGCCAGAACGG - Exonic
1014871832 6:126605569-126605591 CTGTCTGAAGACTGGCAGGCTGG - Intergenic
1016631689 6:146240509-146240531 CAGACTGCAGCCTGGCAGGAAGG + Intronic
1017942011 6:159061365-159061387 CTGTCTGAAGTCTACCAGGGAGG - Intergenic
1017969570 6:159299819-159299841 CCCCATGCAGCCTGCCAGGAGGG + Intergenic
1018996361 6:168713390-168713412 CTGAATGAACCCTGCTAGGATGG - Intergenic
1019285160 7:219673-219695 CTGGGTGAATCCTGCCAGGCAGG + Intronic
1020004731 7:4776264-4776286 CAGCCTGAAACCAGCCTGGAGGG - Intronic
1020184804 7:5950816-5950838 ATGCCTGAAGCCGCCCAGGTAGG - Intronic
1020298112 7:6773928-6773950 ATGCCTGAAGCCGCCCAGGTAGG + Intronic
1021453664 7:20805808-20805830 CTCCCTGAAGCCTCCCCAGAAGG - Intergenic
1022519259 7:30995300-30995322 CTGCCTGAAGACAGCCAGCGTGG + Intergenic
1023895733 7:44431432-44431454 AGGCCTGCAGTCTGCCAGGAAGG - Intronic
1024279768 7:47709617-47709639 CTGGCTGAAGGCTGCCTGGAGGG - Intronic
1024442423 7:49435920-49435942 CTGCCTGAAGCCCCCCTTGATGG - Intergenic
1025284483 7:57651050-57651072 CAGCCTCAGGCCTGCCCGGACGG - Intergenic
1027475209 7:78621691-78621713 CTTCCTGGAGCCTGCAAGGAAGG - Intronic
1028605646 7:92652529-92652551 CTGCCTGAAGCTTTTCAGGGGGG + Intronic
1029667874 7:102007558-102007580 CTGCCACAAGCCAGACAGGAGGG - Intronic
1031978037 7:128106048-128106070 TCACCTGAAGCCTTCCAGGAGGG - Intergenic
1032086539 7:128886794-128886816 CAGCCTTAGGCCTGGCAGGAAGG + Intronic
1034858739 7:154578461-154578483 TTGCACGCAGCCTGCCAGGACGG - Intronic
1035455851 7:159008127-159008149 CAGCCTGAAAACTGCTAGGAAGG + Intergenic
1036949498 8:13127787-13127809 CTTCCTGAAGCTTGTCAGAAAGG - Intronic
1037994370 8:23341859-23341881 CTCCCTGATCCCTGCCAGGCAGG - Intronic
1039244570 8:35594908-35594930 GTGCCTGGAGCCTTCCATGAAGG + Intronic
1039704174 8:39990112-39990134 TTGCCTGAAGCTTGAGAGGAGGG + Intronic
1040277294 8:46020586-46020608 CTGCCTAGAGGCTGCCAGGAAGG + Intergenic
1040377357 8:46839321-46839343 CTGCCTGGACCCTGCCAACAGGG + Intergenic
1040382242 8:46884191-46884213 CTGCCTGGACCCTGCCAACAGGG - Intergenic
1040655217 8:49500142-49500164 CTGCCTCATGACTGCCAGGTGGG + Intergenic
1040892915 8:52336259-52336281 CTGCCTCAAGCCTCCCAGGTAGG + Intronic
1041811315 8:61913767-61913789 CTGCCTGGGGCCTGCCATGGGGG + Intergenic
1042081639 8:65060314-65060336 CTGCCTGCTGCCTCCCATGAGGG + Intergenic
1042388789 8:68208709-68208731 CTGCCTCAGGCTTTCCAGGATGG + Intronic
1042942798 8:74124797-74124819 CTGCCTTAAACCTGGCAGGAGGG + Intergenic
1044474144 8:92606391-92606413 CTGTCTGAACCCTGCCTAGAGGG + Intergenic
1045434816 8:102151789-102151811 TTGCAAGAAGCCTGGCAGGATGG + Intergenic
1047028167 8:120847384-120847406 CTTCCTGAATCCTCCCAGGTAGG - Intergenic
1048014423 8:130484742-130484764 CTGGGTGAAGACTTCCAGGAAGG + Intergenic
1048565934 8:135597239-135597261 CTCTCTGAAGCCTGTCACGAAGG + Intronic
1049278221 8:141730565-141730587 CTGCCTGAAGCCTGCAGCCAGGG + Intergenic
1049509563 8:143020678-143020700 CCTCCTGAAACCTGGCAGGAGGG - Intronic
1049780431 8:144426292-144426314 CTCCCTGAGGCCTCCCAGGCTGG + Intronic
1050173200 9:2843886-2843908 CTGACTGGAGCCTGGCAAGAAGG - Intronic
1050274495 9:3982808-3982830 CTGCCTGAAGCCTTCCATATAGG - Intronic
1051887561 9:21910532-21910554 ATGCCTGAAGACTGGCAAGAGGG + Intronic
1051986157 9:23089701-23089723 CAGCCTGAAGCCTGAAAGAAGGG - Intergenic
1053784452 9:41644210-41644232 CAGCCTCAGGCCTGCCCGGACGG + Intergenic
1054159772 9:61665624-61665646 CTCCCTCAGGCCTGCCTGGACGG + Intergenic
1054160225 9:61668046-61668068 CAGCCTCAGGCCTGCCCGGACGG + Intergenic
1054161332 9:61673836-61673858 CAGCCTCAGGCCTGCCTGGACGG - Intergenic
1054172408 9:61854343-61854365 CAGCCTCAGGCCTGCCCGGACGG + Exonic
1054173178 9:61858183-61858205 CAGCCTCAGGCCTGCCCGGATGG + Intergenic
1054447264 9:65383370-65383392 CAGCCTCAGGCCTGCCCGGACGG + Intergenic
1054448035 9:65387225-65387247 CAGCCTCAGGCCTGCCCGGACGG + Intergenic
1054664364 9:67722598-67722620 CAGCCTCAGGCCTGCCCGGATGG - Intergenic
1054665130 9:67726462-67726484 CAGCCTCAGGCCTGCCCGGACGG - Intergenic
1056688264 9:88784345-88784367 CTGTCTGCATCCTCCCAGGATGG - Intergenic
1056800500 9:89687476-89687498 CCTCCTGAAACCTGTCAGGAGGG + Intergenic
1056805092 9:89722201-89722223 CTGCCCCCAGCCTGCCAGAAAGG + Intergenic
1056837640 9:89970100-89970122 CTCTCTGAAGCCTGCCCGGATGG - Intergenic
1056912940 9:90719691-90719713 CAGCCTGAAGGCTGGCAGGTTGG - Intergenic
1057998247 9:99840183-99840205 CTGGCTGGAGCCTGGCAGGCTGG + Intronic
1058798272 9:108519305-108519327 CTGCTTGAAGTCTGCCAGCTTGG - Intergenic
1059388535 9:113984286-113984308 CTGCCTCAAGCAAGCCAGGAAGG + Intronic
1059405751 9:114097697-114097719 CTGCATGATGCCAGCCAGGCTGG + Exonic
1059577015 9:115500561-115500583 CTCCTTGAAGCCTTCCAGTATGG - Intergenic
1059988849 9:119845505-119845527 CTCACAGAAGCCTTCCAGGATGG - Intergenic
1060044318 9:120327773-120327795 CTGCCTGCAGCCTGGCAGCCTGG + Intergenic
1061096552 9:128460543-128460565 CTGCCAGAAGCCAACCATGAAGG + Intronic
1061856067 9:133442636-133442658 CTGCCTGGACCAGGCCAGGAAGG + Exonic
1062111347 9:134783704-134783726 CTGCCTTTTGCCTGCCAGGTTGG - Intronic
1062516963 9:136941674-136941696 CTGCTTGATGCCTGCAGGGAGGG + Exonic
1203634193 Un_KI270750v1:96083-96105 CAGCCTCAGGCCTGCCCGGATGG - Intergenic
1203668506 Un_KI270754v1:33296-33318 CAGCCTCAGGCCTGCAAGGACGG - Intergenic
1185450790 X:280227-280249 CTGCCTGGAGCATCCCAGCAGGG - Intronic
1185833284 X:3321505-3321527 CTGTCTGTAGCCTCCCAGGCTGG + Exonic
1186110115 X:6246625-6246647 ATGCCTGAAGCCAGTCAGGAGGG - Intergenic
1189384029 X:40521981-40522003 CAGCCTGAAGCCTGCCCACAAGG + Intergenic
1195657905 X:107350004-107350026 CTGCCTGATTCCTGCCAACAGGG - Intergenic
1197571208 X:128153098-128153120 CTGTCTCATGCCTGCCAGAATGG + Intergenic
1198984155 X:142429947-142429969 CTTCCTCCAGCCTGCCAAGATGG - Intergenic
1199511544 X:148628120-148628142 TTTCCTGAAGCCAGGCAGGAAGG + Intronic
1200124549 X:153807166-153807188 CAGCCAGATGCGTGCCAGGAGGG + Intronic
1200302973 X:154997003-154997025 CAGCATGAAGACTGACAGGATGG + Exonic
1200335446 X:155346529-155346551 CTCCTTGAAGCCTGGGAGGATGG + Intergenic
1200351022 X:155494692-155494714 CTCCTTGAAGCCTGGGAGGATGG - Intronic
1200865064 Y:8034706-8034728 CTGCCTGGGCCCTGCCAGCAGGG + Intergenic
1200870823 Y:8096317-8096339 CTGCCTGAACCCTGCTTAGAAGG - Intergenic
1200906832 Y:8492333-8492355 CTGCCTAAGCCCTGCCAGGAGGG + Intergenic
1201645475 Y:16225039-16225061 CTCCCTGTAGCCTGGCAAGAGGG - Intergenic
1201657338 Y:16360273-16360295 CTCCCTGTAGCCTGGCAAGAGGG + Intergenic
1202245139 Y:22812172-22812194 CTGCCTGGAGCATGCCTGTAAGG + Intergenic
1202253257 Y:22894428-22894450 CTGCCTGAGCCCTGCCAACAGGG - Intergenic
1202398129 Y:24445918-24445940 CTGCCTGGAGCATGCCTGTAAGG + Intergenic
1202406247 Y:24528177-24528199 CTGCCTGAGCCCTGCCAACAGGG - Intergenic
1202464535 Y:25141904-25141926 CTGCCTGAGCCCTGCCAACAGGG + Intergenic
1202472652 Y:25224168-25224190 CTGCCTGGAGCATGCCTGTAAGG - Intergenic