ID: 1185348470

View in Genome Browser
Species Human (GRCh38)
Location 22:50321044-50321066
Sequence GCCCTGCTCGGGGTTCCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185348464_1185348470 -5 Left 1185348464 22:50321026-50321048 CCTCCCAGGTCAGGCTGTGCCCT No data
Right 1185348470 22:50321044-50321066 GCCCTGCTCGGGGTTCCATGAGG No data
1185348466_1185348470 -9 Left 1185348466 22:50321030-50321052 CCAGGTCAGGCTGTGCCCTGCTC No data
Right 1185348470 22:50321044-50321066 GCCCTGCTCGGGGTTCCATGAGG No data
1185348465_1185348470 -8 Left 1185348465 22:50321029-50321051 CCCAGGTCAGGCTGTGCCCTGCT No data
Right 1185348470 22:50321044-50321066 GCCCTGCTCGGGGTTCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185348470 Original CRISPR GCCCTGCTCGGGGTTCCATG AGG Intronic