ID: 1185351668

View in Genome Browser
Species Human (GRCh38)
Location 22:50342927-50342949
Sequence CCGGGCCTCCCTCCTGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185351668_1185351684 23 Left 1185351668 22:50342927-50342949 CCTGTGGCAGGAGGGAGGCCCGG No data
Right 1185351684 22:50342973-50342995 ACGGGGGAAACCCCTGCCCCAGG No data
1185351668_1185351679 7 Left 1185351668 22:50342927-50342949 CCTGTGGCAGGAGGGAGGCCCGG No data
Right 1185351679 22:50342957-50342979 GGCCCTTTCCTGGGCCACGGGGG No data
1185351668_1185351675 -2 Left 1185351668 22:50342927-50342949 CCTGTGGCAGGAGGGAGGCCCGG No data
Right 1185351675 22:50342948-50342970 GGGAGAACAGGCCCTTTCCTGGG No data
1185351668_1185351674 -3 Left 1185351668 22:50342927-50342949 CCTGTGGCAGGAGGGAGGCCCGG No data
Right 1185351674 22:50342947-50342969 CGGGAGAACAGGCCCTTTCCTGG No data
1185351668_1185351676 4 Left 1185351668 22:50342927-50342949 CCTGTGGCAGGAGGGAGGCCCGG No data
Right 1185351676 22:50342954-50342976 ACAGGCCCTTTCCTGGGCCACGG No data
1185351668_1185351678 6 Left 1185351668 22:50342927-50342949 CCTGTGGCAGGAGGGAGGCCCGG No data
Right 1185351678 22:50342956-50342978 AGGCCCTTTCCTGGGCCACGGGG No data
1185351668_1185351677 5 Left 1185351668 22:50342927-50342949 CCTGTGGCAGGAGGGAGGCCCGG No data
Right 1185351677 22:50342955-50342977 CAGGCCCTTTCCTGGGCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185351668 Original CRISPR CCGGGCCTCCCTCCTGCCAC AGG (reversed) Intergenic
No off target data available for this crispr